Need help ASAP! Question in picture;)

Solve for x.

Need Help ASAP! Question In Picture;)Solve For X.

Answers

Answer 1

Step-by-step explanation:

[tex]30 + 4x + 2 = 80[/tex]

[tex]4x + 32 = 80[/tex]

[tex]4x = 48[/tex]

[tex]x = 12[/tex]

Answer 2
Answer:x = 12.Step-by-step explanation:30 + (180 - 80) + 4x + 2 = 180=> 30 + 100 + 4x + 2 = 180=> 132 + 4x = 180=> 4x = 180 - 132=> 4x = 48=> x = 12Conclusion:

Therefore, the answer is x = 12.

Hoped this helped.

[tex]BrainiacUser1357[/tex]


Related Questions

Have students write the answer to the Essential Question and draw examples to explain their answer

Answers

What’s the question?

y=6x-17 -12x+2y = -34 ??

Answers

Carry learning!

Stay safe!

Study hard!

describes one way in which the environment's physical characteristics affected colonial economic activities?

Answers

Answer:

Existence of rivers is used as water sources method of distribution

 Existence of resources for material.

Step-by-step explanation:

Hope it helps. Sorry if it's wrong.

0.41g -2) + 1.2 =-(g-1) + 2.9​

Answers

Answer:

g=-3repeated

Step-by-step explanation:

Pls explain how to solve it! (Will mark brainylist)

Answers

Answer:

1,1

Step-by-step explanation:

x=1

y=1

if this is substitution then x IS 7y-6 so then you can replace the x in the other problem with 7y-6 but since it is 5x you will need to do 5(7y-6) which is 35y-30-4y=1

add 30 to both sides to get 35y-4y=31

subtract 4y from 35y to get 31y=31 get the y alone by dividing 31 from both sides to get y=1. then replace the y in the problem where the x is already alone to get x=7×1-6

7x1 is 7 so then 7-6=1 and that gives us x=1.

Hope this helped

Question 14 (5 points)
image

Which of the following is a true statement about the rhombus shown?
Question 14 options:

A)



B)

m∠SPQ = 90°

C)

m∠STP = 90°

D)





Question 15 (5 points)
image

Determine the value of x.
Question 15 options:

A)

x = 90°

B)

x = 45°

C)

x = 20°

D)

x = 4.5°

Answers

Answer:

14) C

15) D, because 90:20=4.5

If 12 candy canes cost $318, what will be the cost of 4 candy canes?​

Answers

Answer:

4 candy canes = $ 106

Step-by-step explanation:

Using unitary method to solve this question.

Given that:

12 candy canes = $ 318

Divide both sides by 12

1 candy cane = $318/12

1 candy cane = $26.5

Now, Multiply both sides by 4

4 candy canes = $ 26.5 * 4

4 candy canes = $ 106

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

Which substances will make a salt when combined?
Question 6 options:

Vinegar and soda

Soda and wine

Detergent and ammonia

Fertilizer and vinegar

Answers

A.Vinegar and soda

-A salt is a substance that contains a cation which is a metal ion or an ammonium ion and an anion derived from an acid. It is an ionic compound that can be formed by the neutralization reaction of an acid and a base.

-For example; a reaction between a soluble base sodium hydroxide and an acid dilute sulfuric acid results to the formation of salt sodium salt. There are also other methods of generating a cell apart from neutralization, such as precipitation reactions and direct synthesis among others,

Help a girl out pls!!!

Answers

Answer: AA Similarity

Step-by-step explanation:

Since both shapes have two corresponding angles that are congruent, AA similarity is applied here.

SOLVE FOR ASA
-GEOMETRY

Answers

Step-by-step explanation:

Hope It Helps You

Here You Answer

ASA=Angle side angel where the angles are connected to the same side


It is given that kc equals bc and c=c because they are vertical angles so you just need one more angle which is b=k

Option c

PLEASEEE HURRY. Please I really need this please

Answers

Answer:

answer is

Step-by-step explanation:

Answer:

final answer is: ABC, A (-5,1), B (-4,6) and C (-1,4)

Step-by-step explanation:

Original: ABC, A (2,-1), B (1,4) and C (-2,2)

translate 3 units to the right and 2 units up: ABC, A (5,1), B (4,6) and C (1,4)

reflected over the x-axis: ABC, A (5,-1), B (4,-6) and C (1,-4)

rotated 180°: ABC, A (-5,1), B (-4,6) and C (-1,4)

Kindly help out with this question!

Answers

Step-by-step explanation:

33+22+90=145

180-145=35

x=180-35

x=145

You have to add all the angles inside together.
So you do 33+22+90 = 145
Then you do 180-145 which is 35 degrees.
Now you know the angle inside of x is 35. We need to find x.
Because a straight line is 180 degrees, you need to do 180-35 which is 145 degrees.
So x = 145

Welcome to Gboard clipboard, any text you copy will be saved here.​

Answers

Answer:

yooo i got the new rank im now expert :0

Step-by-step explanation:

XD

what is 5 7/20 written as a decamal

Answers

Answer:

5 7/20 as a decimal is 5.35

Hope that helps. x

Answer:

Step-by-step explanation:

If your question has a big number 5 and a fraction 7/20, the 5 is going to be in the left side of the decimal, like 5.something ... the 7/20 is going to be the part on the right. If you're allowed to use a calculator just divide 7÷20 and that part goes on the right of the decimal. If you're not allowed to use a calculator then change 7/20 into something/100 ... 7/20× 5/5 gives you 35/100. That is the decimal part. It is written .35 So all together you get 5 7/20 is 5.35

Put these numbers in order from least to greatest.-12/40 -5 19/38

Answers

this is the answer: -5 < -12/40 < 19/38

5. (27:21) Harry says there are 5 families gone on
one block alone. If there are 12 families on that
block, how many families might you expect to be
gone on a street with 60 families?

Answers

Based on the number of families that left and the number in total on that block, the expected number of families gone on the other block is 25 families.

On the first block, the proportion of families that is gone is:

= Number of families gone / Total number of families on block

= 5 / 12

If there are 60 families on a block, the number gone would be:

= Proportion of families gone x Total number of families

= 5/12 x 60

= 25 families

In conclusion, 25 families would be gone

Find out more on proportions at https://brainly.com/question/11570843.

Can you please help me find number for D

Answers

Step-by-step explanation:

the slope of the line between the first 2 points must be the same as the slope between the second and the third point.

the slope is y difference / x difference.

so,

b/a = d/c

-3/1.6 = d/1.5

d = -3×1.5 / 1.6 = -4.5 / 1.6 = -2.8125

a train which is 100 meters long is traveling at a speed of 90km per hour. How many seconds will it take for this train to pass completely through a 300 meter tunnel

Answers

The train will take 16 seconds to pass completely through a 300 meter tunnel.

Let suppose that the train moves itself at constant velocity, the vehicles needs to cover the tunnel length ([tex]L[/tex]) and its length ([tex]l[/tex]), both in meters, to pass through the tunnel, the time taken by the train ([tex]t[/tex]) is described by the following kinematic formula:

[tex]t = \frac{L+l}{v}[/tex] (1)

Where [tex]v[/tex] is the train velocity, in meters per second.

If we know that [tex]L = 300\,m[/tex], [tex]l = 100\,m[/tex] and [tex]v = 90\,\frac{km}{h}\,\left(25\,\frac{m}{s} \right)[/tex], then the time taken by the train is:

[tex]t = \frac{300\,m + 100\,m}{25\,\frac{m}{s} }[/tex]

[tex]t = 16\,s[/tex]

The train will take 16 seconds to pass completely through a 300 meter tunnel.

To learn more on uniform motion, we kindly invite to check this verified question: https://brainly.com/question/12920060

A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5
miles an hour in the same direction. How many hours must B travel to overtake A?

Answers

It will take B 8 hours to travel in order to overtake A.

The relationship among the distance, time and speed can be expressed by using the relation.

[tex]\mathbf{speed = \dfrac{distance}{time}}[/tex]

In this kind of ratio relation, it is pertinent to understand that, the rise in a variable cause a decrease in the other, where the third variable is constant.

Here:

as speed (v) rises;time (t) decreases, and distance (d) is constant

From the given relation:

Distance = speed × time

So, we can have a table expressing the parameters given in the question as follows:

           v            t            d

A          4            t+2     4t + 8

B          5             t         5t

Equating both distance together, we have:

4t + 8 = 5t

collecting like terms, we have:

4t - 5t = -8

t = 8 hours

Therefore, we can conclude that it will take B 8 hours to travel in order to overtake A.

Learn more about distance, time and speed here:

https://brainly.com/question/12199398

what is 90 degrees plus 39 degrees plus 7x+16

Answers

it sounds like maybe 145+7x

Find the slope of the line that passes through the points given in the first column and match them with the appropriate result.
Number: (10,7) and (1,2)
Drags And Drops:5/9, -7/8, 2/7, 6/7, 5/7

Answers

Answer:

5/9.

Step-by-step explanation:

The slope is the difference in y-values  divided by corresponding difference in x-values.

So here:

Slope = (7-2)/(10-1)

= 5/9.

I need help final exam will mark brainliest...
Pablo is walking. The number of minutes he has walked varies directly with the number of calories he has burned. See the graph below. two-part question.


(a) How many calories is Pablo burning per minute?

(b) what is the slope of the graph?

Answers

5 calories per minute
1/2 is your slope.

Answer:

1. 5 calories per minute

2.1/2 is your slope.

Step-by-step explanation:


What is the result of subtracting 4x^2 + 3xy +2y^2 from 5x^2 + 3xy + 6y^2?

Answers

x^2 + 6xy + 8y2

4x^2 + 3xy + 2y^2 - 5x^2 + 2xy + 6y^2

= 4x^2 + 3xy + 2y^2 + -5x^2 + 3xy + 6y^2

Combine like terms:

= 4x^2 + 3xy + 2y^2 + -5x^2 + 3xy + 6y^2

= (4x^2 + -5x^2) + (3xy + 3xy) + (2y^2 + 6y^2)

= -x^2 + 6xy + 8y^2

- 12 \geq - 2 x - 15
[tex] - 12 \geqslant - 2x - 15[/tex]
what is this answer??? plssss help gotta get it done by tomorrow ​

Answers

Answer:

x= -3/5

Step-by-step explanation:

-12>= -2x-15

add 15 to both sides 3>= -2xdivide by -23/-2=x

On a coordinate plane, a line is drawn from point A to point B. Point A is at (negative 4, 8) and point B is at (2, negative 4). What are the x- and y-coordinates of point C, which partitions the directed line segment from A to B into the ratio 3:10? Round to the nearest tenth, if necessary. X = y =.

Answers

The x and y coordinates of point C are -2.6 and 5.2, respectively

The coordinate of the points are given as:

[tex]A = (-4,8)[/tex]

[tex]B =(2,-4)[/tex]

The ratio is given as:

[tex]m :n = 3 : 10[/tex]

The point at the given ratio is calculated as:

[tex]C = (\frac{mx_2+nx_1}{m+n},\frac{my_2+ny_1}{m+n})[/tex]

So, we have:

[tex]C = (\frac{3 \times 2 + 10 \times -4}{3+10},\frac{3 \times -4 +10 \times 8}{3+10})[/tex]

Simplify

[tex]C = (\frac{-34}{13},\frac{68}{13})[/tex]

[tex]C = (-2.6,5.2)[/tex]

Hence, the x and y coordinates of point C are -2.6 and 5.2, respectively

Read more about line ratios at:

https://brainly.com/question/11764811

Answer:

a

Step-by-step explanation:

See the picture first, thank you.

QUESTIONS::

1. Does each graph represent a linear function? Why?

2. What is the domain of the first graph? second graph?

3. What is the range of the first graph? second graph?​

Answers

Answer:

1. yes, both lines are straight

2. domain: (-∞ ∞)

3. range: (-∞ ∞)

Someone please help it’s due today in like 30 min I will give brainliest

Answers

Answer:

First pic X= 13.036

Second pic x= 11.23

Step-by-step explanation:

Pls help right answer gets brainliest

Answers

Answer:

x=3/2

Step-by-step explanation:

      .D                         .I

          9x                           7x+3

.C           .E             .H             .J

7x+3=9x

-7x     -7x

-------------

3=2x

--  --

2  2

x=3/2

Check

9(3/2)=13.5

7(3/2)+3=13.5

A fifth-degree polynomial equation with rational coefficients has the roots 3, 8i, and 7- radical 5. Which are also roots of the polynomial equation?

Answers

Using complex numbers and radicals, it is found that the correct option is C.

When a complex number is a root of a polynomial function, it's conjugate also has to be.

Hence, since 8i is a root of the function, -8i is also a root.

The same is valid for radicals, as they are in the [tex]\pm[/tex] format.

Since [tex]7 - \sqrt{5}[/tex] is a root, [tex]7 + \sqrt{5}[/tex] is also a root.

Hence, option C is correct.

For more on complex numbers and radicals, you can check https://brainly.com/question/25173944

I need help anyone please help.

Answers

Answer:

1/4 or 1/2 good luck my  guy

Step-by-step explanation:

Other Questions
1. What is a myth?a) A true story of gods from long agob) A story that often tells a lesson and explains the creation of somethingc) A fictional story based on real people from history.d) A story with taking animals that tells a lesson. PLEASE HELPP!!!! Which process does osmosis involve?A. movement of solute up a concentration gradientB.movement of solute across the cell membraneC. movement of water across a cell membraneD. movement of water up a concentration gradient Observe the cell as it moves from stage to stage through cell division. What trends can you describe about the cell and its internal contents? Question 8 of 10The molecules that make up food contain energy. How does the human bodyget energy from the food molecules?A. By adding energy to the moleculesB. By breaking and reforming chemical bonds in the moleculesC. By using them to form ionic bondsD. By combining the molecules together A garden hose shoots water horizontally from the top of a tall building toward the wall of a second building 20 meters away. If the speed with which the water leaves the hose is 5 m/sec, how long does it take the water to reach the second building, and what distance does the water fall in this time? Understand how to work with negative bases and negative exponents.5^2 = 5^-2 = (-5)^2 = - 5^2 = (Remember to find the base, then multiply.) Does anyone know the answer for this question? I really need it. ______ is an example of a TCS food.A whole watermelonChickenBreadUncooked (dry) rice A piecewise function is represented by the graph below.On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line goes from (negative 5, 3) to (negative 1, negative 1) and then goes up to a closed circle at (1, 1). The second line has an open circle at (1, 2) and then continues up through (3, 4).What is the domain for the piece of the function represented by f(x) = x + 1?x < 11 x 11 x < 2x > 1 Termina cada conversacin para indicar que la segunda persona est de acuerdo con la primera. 8. Carolina: A m no me gusta limpiar (to clean) la casa. Miguel: A m ____________________________. Immersive Reader(1 Point)tambientampoco Exam GuidelinesExam InstructionsQuestion 4 of 20:Select the best answer for the question.4. Which of the following statements about writing introductions and conclusions is true?O A. Always write the body paragraphs and the conclusion before going back to write the introduction.B. If you have trouble beginning with the introduction, write the body paragraphs first.C. If you're writing a research paper, you don't need an introduction or a conclusion.D. Always write the introduction first and the conclusion last.Mark for review (Will be highlighted on the review page)> Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct Which of the following lines of a dialogue is most appropriate for a naturalist play A. Where are we going? What's happening? B. Does thou require a repast this morn?C. Hark, what light younder window breaks?D. Whither are we bond? At optimum light intensity, which atmospheric gas most directly influences the rate of photosynthesis? *