3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

Answer 1

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.


Related Questions

Carla waters the flowers every other day and
pulls weeds every 5th day. If she did both
chores today, how many days until she has to
do both chores again on the same day?

Answers

Answer:

Using the number 4 as a place holder I think it would be 20 days before she has both chores on the same day

Luis and Erin are playing a game. They each start with 0 points. At the end of the game, Luis has 250 points, and Erin has -250


Which statement about the game is true?

A. Erin and Luis have a total of 500 points.

B. Erin has lost 250 points.

C. Luis has 250 more points than Erin.

D. Erin and Luis have an equal number of points.

Answers

Answer:

B

Step-by-step explanation:

evaluate:

16÷(2+12)2

A. 2 14/25

B. 4 1/4

C. 6 2/5

D. 8 1/4

Answers

The result of the given expression in simplest form is [tex]\frac{4}{7}[/tex].

The given parameters:

16÷(2+12)2

The given expression can be evaluated in the following order as shown below;

add the numbers in the bracket;

2 + 12 = 14

multiply the numbers in the bracket by 2;

14 x 2 = 28

divide the 16 by your result after the multiplication;

[tex]= \frac{16}{28} \\\\[/tex]

divide the numerator and denominator by their common factor which is 4;

[tex]\frac{16}{(2+ 12) 2} = \frac{16}{28} = \frac{4}{7}[/tex]

Thus, the result of the given expression in simplest form is [tex]\frac{4}{7}[/tex].

Learn more about simplification of algebra here: https://brainly.com/question/432678

Which description best describes the association between variables x and y?
picture is below

Answers

Answer:

The dots have a weak positive correlation.

Step-by-step explanation:

The values on the graph, or dots, are generally going upwards, meaning they are positive. If they were generally going downwards, or from the top left to bottom right, they would be negative.

The values are not tightly packed together. If they were, they would have a strong positive correlation. Instead, they are loosely around each other. But because they are not completely random all over the graph, the correlation is weak.

Hence, the values on the graph have a weak and positive correlation.

2/7 divided by 3/4
Amanda

Answers

Answer:

2/7÷3/4=2/7×4/3=8/21

[tex] \rm \ \blue{ \overbrace{ \underbrace{ \tt \color{hotpink} \: \: \: \: \: \: \: \: \: \: answer \: \: \: \: \: \: \: \: \: }}}[/tex]

[tex]\large \color{pink} \frac{8}{21} [/tex]

Step-by-step explanation:

[tex] \huge \color{brown} \frac{2}{7} \div \frac{3}{4} [/tex]

divide by a fraction, multiply by the reciprocal of that fraction

[tex] \large \color{hotpink} \frac{2}{7} \div \frac{4}{3} [/tex]

multiply the fraction

[tex] \huge \color{darkblue} \frac{8}{21} [/tex]

hope it helps

What is the probability of randomly selecting a month pf year and not getting a month that ends in y?

Answers

Answer:

2/3

Step-by-step explanation:

The months whose names end in 'y' include Jan, Feb, May, Jul.  The probability of randomly selecting a month whose name ends in 'y' is 4/12 (remember that there are 12 months in a year), or 1/3.

Thus, the probability of selecting a month whose name does NOT end in 'y' is 8/12, or 2/3.  Note that this event is the 'complement' of the first event:  

P(name does not end in 'y') = 1 - P(name does not end in 'y') = 1 - 1/3 = 2/3

LOOK AT THE PICTURE ATTACHED AND HELP QUICKLLYYYYY PLZZZ!!!!

Answers

Answer: √490  

Step-by-step explanation:

       

Help help hep hep math

Answers

Answer:

f(3) = 2

Step-by-step explanation:

f(3) = 2(3) - 4

f(3) = 2

Y=x+3 please helppppppppppol

Answers

Answer:

(-1, 2), (0,3), (1,4)

slope= 1

y-intercept= (0,3)

Step-by-step explanation:

Help me please ill mark as the brainiest if correct. I don't know how so please tell me

Answers

Answer:

:)))))

Step-by-step explanation:

<3

A certain forest can support a population of 800 deer. There are currently 200 deer in the forest and their population is growing at a rate of 2% per year. Complete the sequence below that models this population growth.



Answers

It would take 70 years for the deer population to reach 800.

An exponential function is in the form:

y = abˣ

where b is the multiplier, y, x are variables and a is the initial value.

Let y represent the population and x represent the time in years.

a = 200, b = 100% + 2% = 102% = 1.02

y = 200(1.02)ˣ

For a population of 800:

800 = 200(1.02)ˣ

ln(4) = xln(1.02)

x = 70 years

It would take 70 years for the deer population to reach 800.

Find out more on exponential function at: brainly.com/question/2456547

Answer: 200, 0.02, and 800

Step-by-step explanation:

An angle measures 157.2° more than the measure of its supplementary angle. What is the measure of each angle?

Answers

Two supplementary angles equal 180 degrees

Subtract the difference from 180:

180-157.2 = 22.8

Divide by 2:

22.8 /2 = 11.4

One angle is 11.4

Now add the difference to 11.4

11.4 + 157.2 = 168.6

The second angle is 168.6

Answer: 11.4 and 168.6

Resuelve la siguiente ecuación lineal: 13-4(5x+1)=3(7-5x)-15

Answers

.........................

19z+12=20z–8
help i dont really understanddd!!!

Answers

Answer:

z = 20

Step-by-step explanation:

subtract 19z from 20z, and add 8 to 12. you will be left with 20 = 1z. Divide 1 by 20 and you will have Xz =20.

I hope this helps!

14.9 x 100 PLS HELP

Answers

Answer:

just move the decimal to the right two place, for two zeroes. The answer is 1490.

Step-by-step explanation: Just simply multiply 14.9 by 100.

Answer:

1490.Step-by-step explanation:multiply 14.9 by 100

How do you know when to rewrite square trinomials and difference of squares binomials as separate factors? How can sums and differences of cubes be identified for factoring?


Answers

Answer:

Step-by-step explanation:

You asked: How do you know when to rewrite square trinomials and difference of squares binomials as separate factors? First, and mostly obviously is when the directions say to factor the given expression. Next, if you're given an equation and asked to solve it. You set it equal to 0 and factor the perfect square trinomial or the difference of squares binomial. Set each factor equal zero and solve. This is a little bit oversimplified but, solutions are roots are zeros are x-intercepts, so if you are asked to find any of those things. Set your equation equal to zero, factor and solve. Also, if you have a rational expression (a fraction with a polynomial on top and a polynomial on the bottom) you would need to factor in order to simplify, to sketch a graph without technology. Anytime you need to simplify, factoring is good to try.

You also asked: How can sums and differences of cubes be identified for factoring? The sum or difference of cubes is in the form a^3 + b^3 or a^3 - b^3

You can memorize how to factor these a^3 + b^3 = (a+b)(a^2 - ab + b^2) and

a^3 - b^3 = (a-b)(a^2 + ab + b^2)

If you take the trouble to multiply these two factors back together you will see how four terms drop out and you get a binomial. Also the is an acronym SOAP to help you memorize it. Factoring cubes is used in the same way as you previous question. To factor, to solve, to simply, to graph. This was a really general question. I hope this helps.

There are some red and blue balls in a bag of 21 balls and the probability of picking 2 red balls out in a row is 1/14 how many red balls are there?

Answers

Answer:

6 red balls

Step-by-step explanation:

The probability in the first pick

6/21

The probability in the second pick (without replacement)

5/20

the requested probability

(6/21)(5/20) = 30/420

simplification

30/420 = 3/42 = 1/14

Hope this helps

Answer:

6 red balls.

Step-by-step explanation:

If there are x red balls then

probability of 2 red balls

= x/21 * (x - 1)/20 = 1/14

x^2 - x / 420 = 1/14

x^2 - x = 30

x^2 - x - 30 = 0

(x - 6)(x + 5) = 0

x = 6.

A man buys an article for $600 and sells it for $710. what is his profit or loss

Answers

Answer:

Profit of $110

Step-by-step explanation:

$710-$600=$110

Can someone help Pleasaseee

Answers

Answer:

i think it's 1.8.

Step-by-step explanation:

why? bc if u add 6/20 + 1.5 = 1.8

i think it's 1.8, im not sure, hopefully it's correct!!

Answer:

1.8

Step-by-step explanation:

you just simplify -6/20 into a decimal and you get .3 then you add it to 1.5.

suppose Amaya wants to bake cookies that require 4.5 cups of flour for a recipe that makes 4 dozen cookies. how much flour would Amaya need to make 126 cookies?

Answers

Answer:

11.8125 cups of flour

Step-by-step explanation:

4 dozen = 48 cookies

126/48=2.625 batches of 48 cookies

2.625 x 4.5 = 11.8125 cups of flour

2 FOR 2.20 UNIT RATE

Answers

Answer: (if your asking for the unit rate of that)

the unit rate is 1.10

Answer:

1.10

Step-by-step explanation:

2 /2 = 1

20/ 2 = 10

1.10 is the unit rate

In order to solve the following system of equations by elimination, which process creates opposite coefficients to eliminate the y variable?

2x + y = 5
x + 4y = -7


A. Multiply the first equation by 4

B. Multiply the second equation by 2

C. Multiply the first equation by -4

D. Multiply the second equation by -2

Answers

Answer:

C. Multiply the first equation by -4

Step-by-step explanation:

Hi there!

In order to eliminate the y values, we would have to find a number in which the sum of the top y value and the bottom y value would equal 0. In this case, the bottom y value is equal to +4 (the +4y), so we would have to find the number that would add to make that 0, which is -4. Since the y value for the top equation is 1, all we have to do is multiply the equation by -4 so that our y value is equal to -4y and the y can be eliminated.

I hope this helps!!

The following stock prices reflect the closing price for the past five days. Find the 3 day SMA
(Simple Moving Average) for days 2-4.
$44.25, $44, $41.75, $40, $39.75

Answers

Answer:

solution

Step-by-step explanation: total=209.75

The large rectangle below represents one whole. What percent is represented by the shaded area? %​

Answers

Answer:

Step-by-step explanation:

would help a lot if you show the picture or describe it very well.

find the greatest common factor GCF and the least common multiple LCM of these Numbers. 8and 9

Answers

Answer:

LCM is [tex]72[/tex]

GCF is [tex]1[/tex]

Step-by-step explanation:

LCM is least common multiplier

LCM of

[tex]8,9=8\times 9\\\\=72[/tex]

GCF is greatest common factor

Factors of [tex]8=1,2,4,8[/tex]

Factors of [tex]9=1,3,9[/tex]

Greatest common factor is [tex]1[/tex]

GCF is [tex]1[/tex]

Don’t know where to start

Answers

Step-by-step explanation:

C = 2πr = 2 x π x 6 = 37.69911

Multiply and fill in the blanks
a) 5pq(p2+ q2+pq)
b) -7pr (pq – qr - rq)
c) (4x-3y) (5x-4a)

with explanation pls !

Answers

The solution to the simplification of the algebraic expressions are;

A) 5p³q + 5pq³ + 5p²q

B) 14pqr² - 7p²qr

C) 20x² - 15xy - 16ax + 12ay

A) We have the expression;

5pq(p² + q² + pq)

Multiplying out using the concept of distributive property, we have;

(5pq × p²) + (5pq × q²) + (5pq × pq)

>> 5p³q + 5pq³ + 5p²q

B) We have the expression;

-7pr(pq – qr - rq)

Multiplying out using the concept of distributive property, we have;

-7p²qr + 7pqr² + 7pqr²

>> 14pqr² - 7p²qr

C) (4x - 3y)(5x - 4a)

By quadratic expansion, we have;

(4x * 5x) - (3y * 5x) - (4x * 4a) + (4a * 3y)

>> 20x² - 15xy - 16ax + 12ay

Read more about simplification of algebra at; https://brainly.com/question/4344214

16 #5) Describe the error in finding the value of x. ​

Answers

They forgot 90. Add 90 to the equation to make it correct.

3.8×102+1.7×103 giving answer in standard form

Answers

Answer: 5.15 x 10^2

Step-by-step explanation:

3.8 x 103 + 1.7 x 103 = 5 x 103 = 515 = 5.15 x 10^2

PLEASE HELP!!!
Bob and Sue are 12 miles apart and moving toward each other. Bob is running at a constant speed of 5mph, and Jada walks at a constant speed of 3mph How long does it take until Bob and Sue meet?

Answers

Answer:

34 miles

Step-by-step explanation:

jn

Other Questions
Who began loaning explorers money during the 1600s? How did the atomic model change due to the research of thomson, rutherford, and bohr? 5. Identify the type of function and the degree of the function: f(x)=6x +3x -11A. Quadratic, degree 3B. Quadratic, degree 2C. Cubic, degree 6D. Quartic, degree 11 Building a String LibrarySometimes when programming you need to introduce a new data type and develop a library of functions for manipulating instances of that data type. Often this is done as methods on a new class but not always.In this assignment, you'll be defining a collection of functions on strings, most of which already exist as methods on the str class. However, you should pretend that they don't already exist and define them as functions. Of course, you can't just use the existing methods. This will give you a bunch of practice on manipulating strings and also on defining functions.In this assignment, you'll be defining a collection of functions on strings. You should define each of these as a new function with a function header as below. The description of each is in the comment supplied. Recall that strings are immutable, so you will have to return a new copy of the string for those that call for you to return a string. If you are returning the same string as the input, just return it; there is no need to make a new copy, and it wouldn't anyway.The only string functions/methods to use:ord, chrindexing and slicingappend (i.e., ``+'')len, in, not inequality comparison (== or !=))Looping over strings (while or for loops) and selection (if statements) are allowed. BUT You cannot convert the strings to other types such as lists.Define each of the following functions, with semantics as indicated by the comment. In each of the following ch is a single character, str, str1, str2 are strings, and i is a non-negative integer. You do not have to validate the inputs, except as indicated; you can assume these types.At least one question asks you to return two values. That really means returning a tuple (pair) of values. You do that as follows: return value1, value2This actually returns the pair (value1, value2). The caller can then assign the members of the pair to two variables: x, y = pairReturningFunction() # assumes function returns a pair z, w = (value1, value2) # assigning a tuple to 2 variablesIf you like, you can use earlier functions in later ones, or define helper functions, though it shouldn't really be necessary. Note that some of these are trivial to write, while others are a bit harder. I have done the first one for you.def myAppend( str, ch ): # Return a new string that is like str but with # character ch added at the end return str + chdef myCount( str, ch ): # Return the number of times character ch appears # in str.def myExtend( str1, str2 ): # Return a new string that contains the elements of # str1 followed by the elements of str2, in the same # order they appear in str2.def myMin( str ): # Return the character in str with the lowest ASCII code. # If str is empty, print "Empty string: no min value" # and return None.def myInsert( str, i, ch ): # Return a new string like str except that ch has been # inserted at the ith position. I.e., the string is now # one character longer than before. Print "Invalid index" if # i is greater than the length of str and return None.def myPop( str, i ): # Return two results: # 1. a new string that is like str but with the ith # element removed; # 2. the value that was removed. # Print "Invalid index" if i is greater than or # equal to len(str), and return str unchanged and Nonedef myFind( str, ch ): # Return the index of the first (leftmost) occurrence of # ch in str, if any. Return -1 if ch does not occur in str.def myRFind( str, ch ): # Return the index of the last (rightmost) occurrence of # ch in str, if any. Return -1 if ch does not occur in str.def myRemove( str, ch ): # Return a new string with the first occurrence of ch # removed. If there is none, return str.def myRemoveAll( str, ch ): # Return a new string with all occurrences of ch. # removed. If there are none, return str.def myReverse( str ): # Return a new string like str but with the characters # in the reverse order. Expected output:>>> from MyStringFunctions import *>>> s1 = "abcd" >>> s2 = "efgh">>> myAppend( s1, "e" )'abcde'>>> myCount( s1, "e")0>>> myCount( s1, "a")1>>> myCount( "abcabc", "a")2>>> myExtend( s1, s2 )'abcdefgh'>>> myMin( "" )Empty string: no min value # Note the None doesn't print>>> myMin( "zqralm" )'a'>>> myMin( "Hello World!" )' '>>> myInsert( "abc", 0, "d")'dabc'>>> myInsert( "abc", 2, "d")'abdc'>>> myInsert( "abc", 4, "d") Invalid index # Note the None doesn't print>>> myPop( "abcd", 1 )('acd', 'b')>>> myPop( "abcd", 0 )('bcd', 'a')>>> myPop( "abcd", 5)Invalid index('abcd', None)>>> myFind( "abcdabcd", "a")0>>> myFind( "abcdabcd", "c")2>>> myFind( "abcdabcd", "f")-1>>> myRFind("abcdabcd", "d")7>>> myRFind("abcdabcd", "e")-1>>> myRemove( "abcdabcd", "a")'bcdabcd'>>> myRemove( "abcdabcd", "x")'abcdabcd'>>> myRemove( "abcdabcd", "d")'abcabcd'>>> myRemoveAll("abcabcabca", "a")'bcbcbc'>>> myReverse( "abcd" )'dcba'>>> myReverse( "" )'' if 240 slices of cake are shared into the same ration 3:5 among the boys and girls how many slices will each students recieve GCF and LCM: word problems. Kiara is printing orange and green forms. She notices that 6 orange forms fit on a page, and 2 green forms fit on a page. If Kiara wants to print the exact same number of orange and green forms, what is the minimum number of each form that she could print? no links pls Drag each tile to the correct box.Match the New Deal artist with the work they did through the Federal Art Project.1.Dorothea Lange2.Jackson Pollock3.Augusta Savage1.photographer2.painter3.sculptor where is the north sea located which region? What is 3.6% as decimals? Find m angle O Y X in the diagram above.URGENT!! What starts with a p has a t in the middle and has an R at the end that has 12 letters that is for ur bodyNote: its not any subject for school and its not anything for school so ignore the mathematics subject thing. Going too far beyond what the body can handle with vigorous exercise, especially without taking time to build up to the level of exercise, is an example of __________. A. Overuse B. Overexertion C. Incorrect technique D. Determination Please select the best answer from the choices provided. A B C D. who takes over if the president and vice president are no longer able to perform their duties as president? How do plants use the energy from the sunlight? I remember when the world broke in, To rip apart my soul, For years after that one event,I thought myself not whole, My hours were spent with trying, To fix it up with tape and glue,Until one day I discovered,Everyone else was broken too,Here we were with pieces, Of ourselves in both our hands, So fragile and so open, That I began to understand, Maybe I'd been greedy, To want my soul all to myself, When it could be a lot more helpful, In the palms of someone else, Now every time I go somewhere, I leave part of me behind, And collect all of the pieces, Of others' souls that I can find, So when I'm meeting someone new, It's not just me they get, But also tiny fragments, Of all the others that I've met, And my life's become much bigger, Now that it's home to things so small, And if this is what "broken" means, I do not mind at all. Which type of persuasion may account for the fact that Jane is willing to drive her friend an hour to the airport after her friend first agreed to only drive her to the store? pllsss hhheeeelllppp this assignment is a lot of point and it is past due A glacier can travel over the surface of Earth and reshape it. The chart describes three things a glacier can do.Glacial Actions:1. breaks large rocks into smaller ones2. pushes broken rocks ahead of itself3. leaves broken rocks behind when the front edge meltsWhich terms BEST describe these glacial actions in the order as presented?a. weathering, erosion, depositionb. erosion, chemical weathering, depositionc. deposition, weathering, erosiond. chemical weathering, mechanical weathering, erosion Why do modern Psychologists use trait theory as the method of helping individuals understand their personality? thissssssssssssssssssssssssssssssssssssssss