Is water wet or does it feel wet?

Answers

Answer 1

Answer:

Water feels wet. This is because the sensation of wetness is largely due to the cooling caused by evaporation, and water has a rather high latent heat of vaporisation, which is the amount of heat it removes from its surroundings in order to convert liquid water into water vapour.

Explanation:

Answer 2

Answer:

When something is wet by definition it has water molecules clinging to it, in terms of cohesion water molecules cling to eachother making water by definition wet

Explanation:

you are welcome


Related Questions

Which of the following is the strongest conclusion to an informative essay about Sherlock Holmes's strongest character traits as a detective?

A. In conclusion, Sherlock Holmes's drive to find answers and his observation skills led to his success as a detective. Plenty of readers admired this detective and went on to become detectives, too. While none were as famous as Holmes, many joined him in saying, "It's elementary, Watson!"

B. In summary, Sherlock Holmes was determined to find answers, no matter what.
He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

C. To conclude, Sherlock Holmes became a detective so that he could use his character traits for good. He searched for answers in The Mystery of the Lost Gem, even when Mrs. Blakely doubted him. Sherlock's drive to find answers was rewarded at last.

D. To summarize, Sherlock Holmes's character traits led to his success as a detective. Many readers admired this detective and tried to imitate him, even going so far as to say, "It's elementary, Watson!"

Answers

The strongest conclusion to this informative essay about Sherlock Holmes is: B. In summary, Sherlock Holmes was determined to find answers, no matter what. He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

What is an informative essay?

An informative essay can be defined as a literary work that presents factual information about an event, people, places or things.

This ultimately implies that, the main purpose of an informative essay is to provide sufficient information and explanation about an event, object, person (individual), places, or phenomenon to the readers (audience).

In this context, Sherlock Holmes's strongest character traits such as his five senses, as a detective should be highlighted or presented to the readers (audience).

Read more on informative essay here: https://brainly.com/question/19949636

How does tsunami occurs? explain its effect

Answers

A tsunami usually occurs after an earthquake. Tsunamis can cause flash floods, destroy building and ships, cause extensive damage to human made objects as well as the environment, and cause death to both humans and animals.

How many miles away is the moon from earth?

Answers

The moon is 238,900 miles away from earth

Which one of the following is the softest?

(A) Aluminium

(B) Iron

(C) Lithium

(D) Sodium

Answers

Answer:

Sodium

Explanation:

Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .

6-10 Importance of planting​

Answers

Answer:

Importance of Planting

Explanation:

Trees increase property values.

Trees clean the air.

Trees slow water runoff.

Trees prevent soil erosion.

Trees help buffer noise pollution.

Trees cool our homes, streets, and cities.

Trees can save you money on energy costs.

Trees are beautiful.

biology The studly of cells is called what​

Answers

Answer:

Cytology is the study of cells as fundamental units of living things.

Which behavior is a response that is determined by heredity?
O fighting for protection
O All behaviors are determined by heredity.
O hunting in packs
O sleeping

Answers

Which behavior is a response that is determined by heredity?

Answer:

D. Sleeping

D.) sleeping

Behavioral responses such as sleep has been found to be hereditary or affected by your genes.

[tex]#Keeplearning [/tex]

Compare how energy is used worldwide with how it is used in the United States.

Answers

Answer:

the U.S comsumes almost 15% of the worlds energy

Explanation:

yes

A divergent boundary at two oceanic plates can result in a
-mid-ocean ridge
-volcanic island arc
-continental volcanic arc
-subduction zone

Answers

The answer is -volcanic island arc.

Effects that are found at a divergent boundary between oceanic plates include: a submarine mountain range such as the Mid-Atlantic Ridge; volcanic activity in the form of fissure eruptions; shallow earthquake activity; creation of new seafloor and a widening ocean basin.

True or False? A forest of conifers holds more living matter than tropical rainforests.

A. True

B. False

Answers

Answer:

true

Explanation:

The statement "a forest of conifers holds more living matter than tropical rainforests" is definitely true.

How do coniferous forests differ from tropical rainforests?

Tropical Rainforests undergrowth is evenly distributed. Not much plant growth as very little sunlight passes through the canopy and reaches the forest floor, But coniferous has little undergrowth due to the low amount of sunlight received and the low soil nutrient.

The tropical rainforests have higher and large heights of trees and other vegetation. Due to this, other living matter must definitely be inhibited due to the absence of sunlight.

While in conifers, the height of trees and other vegetation is shortly limited, due to which other living matter also receive a high amount o sunlight. As a result of this, they grow and reproduce successfully.

To learn more about Tropical rainforests, refer to the link:

https://brainly.com/question/1146251

#SPJ2

Which environmental change would most likely result in bullfrog offspring that are able to store more water than bullfrogs in previous generations?
A.
a dry season that lasts for a month
B.
flooding that turns the valley into a lake
C.
a drought that lasts for a very long time
D.
a rainy season that lasts for a month

Answers

Answer:

C.

a drought that lasts for a very long time

Label what each letter means (photosynthesis)

Answers

Answer:

A- sunlight B-Oxygen C-carbon dioxide emission

Explanation:

The objective lenses of the compound light microscope are attached to the

Answers

Answer:

C

Explanation:

its C

Answer:

The objective lenses of the compound light microscope are attached to the rotating nosepiece.

Explanation:

If the side of a cubical cell doubled, what would the cell then require? Select all the correct answers.

A. eight times more nutrients
B. to excrete eight times more waste
C. four times more nutrients
D. to excrete four times more waste

Answers

Given what we know, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

Why would the cell require more nutrients?

This has to do with the ratio between surface area and volume. Since volume is squared when calculating it, the volume of a cell increases much more rapidly than that of its surface area. So a cell that doubles in size would quadruple in volume, needed four times as many nutrients to maintain its internal processes.

Therefore, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

To learn more about cells visit:

https://brainly.com/question/5763151?referrer=searchResults

Penelope is adding fractions while taking a math test. What part of her brain is at work?
spinal cord
cerebrum
cerebellum
hypothalamus

Answers

Answer:

Cerebrum

Explanation:

The cerebrum is the part of the brain that includes the hippocampus, which is responsible for solving math problems.

Answer:

cerebrum

Explanation:

edge 2022

Which of the following would not be found in blood serum? (2 points)

Antibodies
Platelets
Nutrients
Wastes

Answers

Answer: The answer is (B) Platelets. You wouldn't find Platelets in blood serum.

Explanation:

The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by
the action of
(A) decomposers
(B) producers
(C) primary consumers
(D) secondary consumers

Answers

Answer:

A

Explanation: Just what decomposers do, break down organic and sometimes inorganic material

The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by the action of decomposers. Thus, the correct option is A.

What is the Environment?

The Environment may be characterized as anything which is present in the surrounding of any living organism. The term "Environment" was given by Carlyle.

Decomposers are organisms that can significantly have the capability to break down dead, decaying organisms that remarkably contain organic as well as inorganic material in their body composition.

Such types of organisms convert dead and decaying matter into humus. They are also known as detrivores.

Producers are those that can synthesize their own food with the help of sunlight through the process of photosynthesis. While primary consumers are those that directly deed on the producers. They are also known as herbivores.

Therefore, decomposers are living organisms that perform the action of converting all organic and inorganic materials of the living organisms into the environment.

To learn more about Decomposers, refer to the link:

https://brainly.com/question/380333

#SPJ6

If allowed to grow naturally, minerals will form:

conglomerates
layers
rocks
crystals​

Answers

Answer:

D.) crystals

Explanation:

have a good day :)

Answer:

crystals​

Reason :

Crystals occur in nature when particles cluster to solidify as a liquid cools down and solidify. This is referred to as crystallization, and it can occur when molten solidifies or when liquid evaporates from an organic combination.

An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.

Answers

Answer:

B

Explanation:

there are complex feeding mechanisms at work to protect the other species in the food web

25 POINTS
Check all the continents below that experienced an increase in average annual temperature.

Europe

Africa

North America

South America

Antartica

Australia

Asia

Answers

Answer:

Europe, North America and Asian:

- Explain the differences in growth between animals and plants

Answers

Answer:

The differences are given below

Explanation:

Plants differ from animals in their manner of growth. As young animals mature, all parts of their bodies grow until they reach a genetically determined size for each species. Plant growth, on the other hand, continues throughout the life span of the plant and is restricted to certain meristematic tissue regions only.

Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?​

Answers

Higher pleasure is a pleasure that would be chose by a greater number in the population.

What is higher pleasure?

The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.

I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.

What is higher pleasure: https://brainly.com/question/22406307

Which of the following describes a step in recycling raw materials to make the same or new items?

I. Use a directory to learn how to recycle a material.
II. Use refillable water bottles.
III. Use up a product completely.

I only
II and III
I and III
I, II, and III

Answers

Answer:

I only --- Use a directory to learn how to recycle

Explanation:

Number II and III do not help in recycling raw materials to make same or new (just took test got it right)

Using a directory to learn how to recycle a material is the step in recycling raw materials to make the same or new items. The correct option is A.

What is recycling?

Recycling is the process of converting waste materials in to other unique raw materials for the production of innovative products.

A material with high recyclability is one that can be easily recycled, which also means that its material properties need not depreciate significantly compared to those of simple material.

Recycling consists of three steps namely collecting recyclable materials, transforming recycled materials into new products, and selling and purchasing products containing recycled material.

The step in recycling raw materials to make the same or new items is to use a directory to learn how to recycle a material.

Thus, the correct option is A.

For more details regarding recycling, visit:

https://brainly.com/question/11861824

#SPJ5

What is the mRNA that would be transcribed from this strand of DNA?

Answers

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Name the chemical that helps in providing the ideal pH for pancreatic amylase to function in the human body.*​

Answers

Answer:

What is the chemical that helps in providing the ideal PH for pancreatic amylase to function in the human body?

Explanation:

This allows the protein lipase to break down and digest the fat in the small intestine much more quickly. The pancreas secretes bicarbonate to neutralize the acidity of chyme and pancreatic amylase to aid in the digestion of carbohydrates.

A student is designing a device for humans to communicate through detectable light. Which waves should the student use from the electromagnetic spectrum? A X-ray waves B visible waves C infrared waves D ultraviolet waves

Answers

A.it should be a x-ray waves

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes.

2.

A tetrad is made up of

A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids.

3.

Which of the following statements about crossing over is TRUE?

A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above

4.

Crossing-over occurs during prophase I of meiosis.

A) True
B) False

5.

Crossing-over allows the reassortment of linked genes.

A) True
B) False

Answers

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.

B) sister chromatids of homologous chromosomes.

C) sister chromatids of non-homologous chromosomes.

D) non-sister chromatids of homologous chromosomes.

E) non-sister chromatids of non-homologous chromosomes. ✓

During meiosis, the two chromosomes in each parent,swipe their place resulting in a hybrid new genetic material

2.A tetrad is made up of

A) four non-homologous chromosomes.

B) four non-homologous chromatids.

C) four homologous pairs of chromosomes.

D) two homologous pairs of chromosomes.

E) two homologous chromosomes, each consisting of two chromatids.

Tetrad is a group of four chromatids formed in pachytene stage of meiosis

3. Which of the following statements about crossing over is TRUE?

A) It occurs only in males.

B) It occurs only in some chromosomes.

C) It occurs only between genes that are heterozygous.

D) It results in reduced genetic variation among gametes.

E) None of the above

The process of crossing over takes place between homologous chromosomes to increase genetic diversity

4.Crossing-over occurs during prophase I of meiosis.

A) True ✓

B) False

crossing over helps in genetic variation and occurrs between prophase 1 & metaphase 1

5. Crossing-over allows the reassortment of linked genes.

A) True

B) False

Crossing over helps in the reassortment of non-sister chromatids of non-homologous chromosomes
A crossover in meiosis is an exchange of genetic material between non-sister chromatids of homologous chromosomes. Thus, the correct option for this question is D. A tetrad is made up of two homologous chromosomes, each consisting of two chromatids. Thus, the correct option for this question is E. The statement which is true about crossing over is none of the above. This is because the process of crossing over occurs between homologous chromosomes. Thus, the correct option for this question is E. The statement "the process of crossing over occurs during prophase I of meiosis" is definitely true. The statement "Crossing-over allows the reassortment of linked genes" is definitely true.

What is Crossing over?

Crossing over may be defined as the process through which the exchange of genetic material between homologous chromosomes takes place that results in the mixture of parental characteristics in the offspring.

According to the context of this question, the process of crossing over takes place during the Pachytene stage of meiosis which significantly involves the reassortment of linked genes.

Therefore, each of the given questions is well answered above.

To learn more about Crossing over, refer to the link:

https://brainly.com/question/927405

#SPJ2

Which of the following can cause damage to blood vessels if not treated?
hypertension
smoking
obesity
genetics

Answers

Answer:

hypertension

Explanation:

because high blood

Answer:

hypertension

Explanation:

High blood pressure is a major risk factor for cardiovascular disease.

8. In
In the
rock Cyce, igneous, sedimentary
and metamorphic
become magma again.
How does this happen?



Earth science

Answers

Answer:

Over millenia, these rocks get pushed back into the Earth's mantle, and get pushed into a volcano heating it up and turning it into magma.

Explanation:

Magma is molten rock, meaning existing rocks must be getting melted, the way the melting happens is by the rocks getting pushed into the ground by landforms and penetrating the mantle, this is how the cycle starts all over again.

Which of the following would NOT be considered growth and development?

Answers

The statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.

What is growth and development?

Growth in living organisms refers to the increase in size and number of living cells while development refers to the progressive changes in within an organism.

Growth and development can be exemplified by the following scenarios:

A single cell getting larger before dividingAn egg becoming multiple cellsAn organism going through multiple stages of life

Therefore, this reveals that statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.

Learn more about growth and development at: https://brainly.com/question/8347621

Other Questions
A group of 180 students is divided into 20 teams for a competition. b. Part way through the competition, the students are gathered together and divided into 15 teams. If there are still 180 students in the competition, how many students are on each team now? (Enter your answer as a whole number. For example, 5) A principal becomes an amount of 1080 in one year at the rate 8% per annum. What is the principal ? I WILL GIVE BRAINLIEST :) a lone stranger and pronto What does the protagonist decide and what action does the protagonist take because of this decision? The diameter of a circle is 10 in .find the cirumference to the nearest tenth Hi can you please help me out Help help math math math How many liters of solvent would be needed to create a 5.5 M solution from 22 moles of sodium chloride? Which product is positive 7.3. Podemos inferir que las adaptaciones y libroscondensados(A) producen los efectos contrarios, que hace los niosSodiar los libros clsicos(B) son ridculos e inmadurose6:(C) pueden cultivar un agradecimiento de los librosclsicos(D) no pueden contener el "verdadern Ruiinte" Is this creative writing?I know this is long but I wrote 2 versions of the story each a little different which one suits best as the word limit is 300?1.I glanced at my watch to become so fixated on the time, it read 4:43pm August 23rd 2025. Being an ex military officer you see a part of the world not many get to see, the violent cold nature of battle. No one on the battlefield are really enemies, we are just pitted against each other, in the end we are just doing our job so that no one else carries that burden. We pity our enemies as they cry for help, the screams drive most insane but the ones that aren't shaken take it the worst. I hate war. In this world dictated by a paper note, you can get anything if you have enough money. Money creates greed and greed breeds hate therefore relationships shatter and nations fall into chaos. Well that's what got us into this mess 3 years ago when WW3 started with Ukraine and Russia, 3 years ago that was, and they managed to drag every nation into it. Little did anyone know a progessive bomb was created, which couldnt be disarmed and only grows in power, doubling every year. A weapon which gives full control over the world to one nation, to the individual who controls it. A threat which endangered every living being on the pale blue dot called Earth. The world bomb it was called, currently able to incinerate half the planet in an instant, soon to be capable of wiping 8 billion people off the planet. One would now say there's nothing we can do, yet as I stand before the fuse only one answer seemed to cross my mind. How could anything be more important than keeping humanity from being totally wiped out? You either die a hero or live long enough to become the villain they said. As I pulled the fuse to be engulfed by the white light the words leave my mouth, So, was I a hero or a villain I'm the same as you i didn't have a choice (not sure if i should add this last line)2.I squinted at my watch in the frigid dim lit bunker, it read 4:43pm August 23rd 2025. I hate war. In this world dictated by paper notes, you can get anything if you have enough money. Money creates greed and greed breeds hate therefore relationships shatter and nations fall into chaos. Well that's what got us into this mess 3 years ago when WW3 started with Ukraine and Russia, 3 years ago that was, and they managed to drag every nation into it. Little did anyone know a progessive bomb was created, which unable to be disarmed and only grows in power, doubling every year. A top secret nuclear weapon developed by Russia which gives control over the world to one nation, to the individual who controls it. Only a select few know of it, hidden from the rest of the world, it would look like a repercussion of war as everyone tries to hide the truth. A threat which endangered every living being on the pale blue dot called Earth. The world bomb it was called, currently able to incinerate a third of the planet in an instant, soon to be capable of wiping out 8 billion people off the planet. One would now say there's nothing we can do, yet as I stand before the fuse only one answer seemed to cross my mind. How could anything be more important than keeping humanity from being wiped out? You either die a hero or live long enough to become the villain they said. As I pulled the fuse to be engulfed by the white light the words left my mouth, So, was I a hero or a villain I'm the same as you i didn't have a choice (not sure if i should add this last line) Cars are made of several metals, including iron, steel (a mixture of iron and carbon), aluminum, copper, and zinc. Which of these metals would the magnet attract? what do i do can u help:) Managers use the four levers of targeting elements of change to ______. A. learn more about the competition B. diagnose problems C. create new products D. release products to consumers can someone help me please I didn't understand Which evidence best supports the idea that Mrs. Medlock is hiding something from Mary?"'Youre one that needs someone to look sharp after you. Ive got enough to do.'""'You didn't hear anything of the sort...'""She did not cry, but ground her teeth.""'She went out of the room and slammed the door after her...'" What is the decimal equivalent of 1/3?A. 3.1B. 1.3 _C. 0.3D. 0.3 Who is at the bottom of the Corporate Structure? Identify the percent in 12 is 50% of 24 _______ is the phenomenon in which it takes longer to recognize a word that shares sounds with many other words than it does to recognize a word that is very phonetically distinct from other words. Solve the following equation, answer as a reduced, mixed number. Then place the correct number in the box provided. 4(7 - 3x) = 7(4 - 2x)