Calculate the distance between the points G=(-9, 8) and C=(-1, 1) in the coordinate plane.
Give an exact answer (not a decimal approximation).

Answers

Answer 1

Answer:

10.63

Step-by-step explanation:

d = √((x2-x1)2 + (y2-y1)2)

Step by step procedure:

Find the difference between coordinates:

01(x2-x1) = (-1 - -9) = 8

(y2-y1) = (1 - 8) = -7

Square the results and sum them up:

(8)2 + (-7)2 = 64 + 49 = 113

Now Find the square root and that's your result:

Exact solution: √113 = √113

Approximate solution: 10.6301


Related Questions

What is the difference of the two polynomials? (7y2 6xy) â€"" (â€""2xy 3) 7y2 4xy â€"" 3 7y2 8xy â€"" 3 7y2 4xy 3 7y2 8xy 3.

Answers

Answer:

There is no difference

Step-by-step explanation:

The difference between the polynomials is 7y² + 8xy - 3

Polynomials are functions that have a degree of power greater than two.

According to the question we are to find the difference between the polynomials (7y2 + 6xy) - (-2xy + 3)

f(x, y) = (7y^2 + 6xy) - (-2xy + 3)

f(x, y) = 7y² + 6xy + 2xy - 3

f(x, y) = 7y² + 8xy - 3

Hence the difference between the polynomials is 7y² + 8xy - 3

Learn more on polynomials here: https://brainly.com/question/4142886

ANSWER ASAP PLS

A line passes through the points (-6, 4) and (-2, 2). Which is the equation of the line?
A y=-3x+1
B x = 1/2x +7
C y=-2x-8
D y = 2x + 16

Answers

Step-by-step explanation:

m = (y2-y1)/(x2-x1)

= (2-4)/(-2+6)

= -2/4

= -1/2

now

y=mx+c

4=-1/2(-6)+c (you can take any x and y from the given two points. I took from (-6,4)

or,4= 3+c

therefore, c=1

now

y=mx+c

y= -1/2x+1

or, y = 1-x/2

Here are the graphs of L(x) and R(x) what are the values of L(2) and R(2)

Answers

Using the function graph given, it is found that:

L(2) = 7.R(2) = 1.

When a piece-wise function is given, that is, a function that has multiple definitions, the numeric value at x when the definition changes is given by the closed circle.

For function L(x), when x = 2, the closed circle is at y = 7, hence, L(2) = 7.For function R(x), when x = 2, the closed circle is at y = 1, hence, R(2) = 1.

To learn more about the use of graphs to analyze a function, you can take a look at https://brainly.com/question/21447009

29. Martin has some dollar notes. 20% of the notes are $10 notes, 40% of
the remainder are $5 notes and the rest are $2 notes. He has a total
of $1026. How many notes does Martin have altogether?

Answers

Answer:

225 notes

Step-by-step explanation:

Let the number of notes is x.

20% of notes is:

0.2x

40% of the remainder is:

40% of 0.8x, so it is 0.8x*0.4 = 0.32x

Remaining notes are:

x - 0.2x - 0.32x = 0.48x

Total of the notes:

0.2x*10 + 0.32x*5 + 0.48x*2 = 10262x + 1.6x + 0.96x = 10264.56x = 1026x = 1026/4.56x = 225

a perfect score in bowling is 300 points. you get a perfect score if you knock down 120 pins in 10 frames. what are the decimal value and percent of the number of pins knocked down in a relation to a perfect score?

Answers

Answer:

number of pins to perfect score

120/300=40/100

percent means parts out of 100

40/100=40%

answer is 40% or 0.40

NOTE: To find the percentage we will multiply decimal value of  number of know down pins to a perfect score by 100

Number of know down pins to a perfect score= 0.4 x 100

Number of know down pins to a perfect score=40%

If correct please give brainliest

Stay safe and healthy

Thank You

1/3x² + x+5/3x² = 1/9

HAHAHAHA......​

Answers

Answer:

[tex]\huge \bf༆ Answer ༄[/tex]

Step-by-step explanation:

Let's solve for x ~

[tex] \sf \dfrac{1}{3} {x}^{2} + x + \dfrac{5}{3} {x}^{2} = \dfrac{1}{9} [/tex]

[tex] \sf \dfrac{(1 + 5)}{3} {x}^{2} + x = \dfrac{1}{9} [/tex]

[tex] \sf \dfrac{6}{3} {x}^{2} + x - \dfrac{1}{9} = 0[/tex]

[tex] \sf2 {x}^{2} + x - \dfrac{1}{9} = 0[/tex]

Multiply each term with 9 on both sides of the equation

[tex] \sf(2 {x}^{2} \times 9) + (x \times9 ) - ( \dfrac{1}{9} \times 9 ) = 0 \times 9[/tex]

[tex] \sf18 {x}^{2} + 9x - 1 = 0[/tex]

Now, let's use Quadratic formula to find its roots ~

[tex] \sf \dfrac{ - {b}^{} \pm \sqrt{b {}^{2} - 4ac} }{2a} [/tex]

where,

b is Coefficient of x = 9

a is Coefficient of x² = 18

c is the constant term = -1

Let's find the roots ~

[tex] \sf \dfrac{ - 9 \pm \sqrt{(9 {}^{2}) - (4 \times 18 \times - 1) } }{2 \times 18} [/tex]

[tex] \sf \dfrac{ - 9 \pm \sqrt{81- ( - 72) } }{36} [/tex]

[tex] \sf \dfrac{ - 9 \pm \sqrt{81 + 72} }{36} [/tex]

[tex] \sf \dfrac{ - 9 \pm \sqrt{153} }{36} [/tex]

[tex] \sf \dfrac{ - 9 \pm 3\sqrt{17} }{36} [/tex]

[tex] \sf \dfrac{3( - 3 \pm \sqrt{17} )}{36}[/tex]

[tex] \sf \dfrac{ - 3 \pm \sqrt{17} }{12} [/tex]

Therefore the value if x are ~

[tex] \sf \dfrac{ - 3 + \sqrt{17} }{12} \: \: and \: \: \sf \dfrac{ - 3 - \sqrt{17} }{12} [/tex]

I hope it helps ~

A sector with a radius of 6cm has a central angle measure 4pie/9 (in radius)

What is the area of the sector ?


Answers

Answer:

8πcm² = 8pi cm²

Step-by-step explanation

The formula for area of a sector = ½r²θ

Where r = radius = 6cm

θ = central angle = 4pi/9 in radians = 4π/9

Area of the sector = 1/2 × 6² × 4π/9

Area of the sector = (144π/18)cm²

Area of the sector = 8πcm²

Therefore, Area of the sector =

8πcm² = 8pi cm²

Jennifer competed in a race that included running and biking. She ran 134 miles and bicycled 3.6 miles. Her total time was 0.7 hour. What was her approximate average speed in miles per hour?

Answers

Answer:

not 100% but i think 196

Step-by-step explanation:

you go 134+3.6 then just divide by 0.7

Solve for the variable! 4 questions! Need to turn it in soon so ASAP!
Please show your steps! Thank you!

Answers

Answer:

Step-by-step explanation:

How much does darma earn if she babysits 6 hours

Answers

Answer:

42$

Step-by-step explanation:

Since she earns 28 $ in 4 hours

Let the hour : X

4x=28

X=28/4

X=7

Since the question want 6 hours

Then she earns

6x7=42$

.if cant represents it no problem but just i need the answer please ​

Answers

Answer:

The solution is in the photo

Y=-3x+1 y+5=-3(x-2) what do the following two equations represent A)The same line B)Distinct parallel lines C)Perpendicular Lines D)Intersecting, but not perpendicular lines

Answers

Answer:

C) perpendicular lines

A_________is a common multiple of two or more denominators

Answers

Answer:

(LCM)

Step-by-step explanation:

Least common multiple = LCM

HOPE THIS HELPS :)

Please help question in pic

Answers

a is correct friend
I just used the midpoint formula. Hope this helps!

Please answer the following question
(d+m)A=2
A= ?

Answers

Answer:

A is equal to 3

please mark me as brianleast

(d+m)A=2
It can be rewritten as A(d+m)=2
The opposite of multiplying is division is divide (d+m) on both sides

A=2/(d+m)

Can i get some help :

Answers

dang this looks so confuseing

Chang made $156 for 13 hours of work at the same rate, how many hours would he have to work to make $108?

Answers

Answer:

  9 hours

Step-by-step explanation:

"At the same rate" means time and wages are proportional.

  time/wages = t/$108 = (13 h)/$156

  t = 108(13 h)/156 . . . . . . . . . . . . . . . units of dollars cancel

  t = 9 h

Chang would have to work 9 hours to make $108.

NEED HELP PLZ HELP ME ….

Answers

Answer:

R= -0.95

Step-by-step explanation:

HOPE THIS HELPS :)

Examples:

3x (coefficient is 3)

4t (coefficient is 4)

Review

Directions: Name the coefficient (s) in the following expressions:

1. 9s + 4t

2. 46rs + 10x

3. 18q + 14x

4. 10x + 14y

5. 17rs + 32x

6. 5x + 7y - 5z

7. 3ab + 70m

8. 3r + 20a + 10m

9. 7k + 16m

10. 7r + 5s

11. 9j + 120m

12. 12k + m

13. 6c + 15h + w

14. 2c - 19d + 12f

15. 3t + 14r - 31j

Answers

Answer:

1. 9 + 4

2. 46 + 10

3. 18 + 14

4. 10x+ 14

5. 17 + 32

6. 5 + 7- 5

7. 3 + 70

8. 3 + 20 + 10

9. 7 + 16

10. 7 + 5

11. 9 + 120

12. 12  

13. 6 + 15 +  

14. 2 - 19+ 12

15. 3 + 14 - 31

Step-by-step explanation:

The value of X is units in length.

Answers

Answer:

x=17.5 we do that 5*3.5 =17.5

123.90706 written to 3 decimal places is

Answers

Answer:

123.907

Step-by-step explanation:

Find the area.
2 cm
2 cm
4 cm

Answers

Answer:

  6 cm^2

Step-by-step explanation:

The area of the trapezoid is given by the formula ...

  A = 1/2(b1 +b2)h

  A = 1/2(4 cm +2 cm)(2 cm) = 6 square centimeters

Answer:

6 cm^2

Step-by-step explanation:

The area of the trapezoid is given by the formula ...

A = 1/2(b1 +b2)h

A = 1/2(4 cm +2 cm)(2 cm) = 6 square centimeters

= 3 and 1/2 × 3 and 1/2

Answers

Step-by-step explanation:

please mark me as brainlest

How I can answer this question, NO LINKS, if you answer correctly I will give u brainliest!

Answers

Answer:

Hes right 304.8 millimeters in a foot.

Through the successful study of personal finance, an individual will be better prepared to calculate financial risks able to spend available assets. faced with long-term challenges. more likely to avoid high opportunity costs.

Answers

Answer:

A. better prepared to calculate financial risks

Step-by-step explanation:

Through the successful study of personal finance, an individual will be better prepared to calculate financial risks.

What is Personal Finance?

Personal finance is a broad word that encompasses money management, as well as saving for the future.  Personal finance also includes some of the following:

Budgeting, Banking,Insurance, andEstate preparation etc

A successful study of personal finance can help in various ways such as:

Assisting in increasing our income stream and cash flows. Keeping track of our expenses and spending habits.Tax preparation and careful budgeting guarantee that our hard-earned money is not wasted on needless purchases.

Learn more about personal finance here:

https://brainly.com/question/2961383

what is the slop of 2x-5y=10

Answers

Answer:

2/5

Step-by-step explanation:

Subtract 2x from both sides

-5y = -2x + 10

Divide both sides by -5

y = 2/5 x -2

The slope is 2/5.

The answer is 2/5

Subtract 2x from both sides

Then divide by -5.

I NEED HELP PLZZ, can someone help me out w/ this question plz?

Answers

Answer:

both of them are correct !

-1/1 = 0

and -1+1 = 0, and 0/-1 equals 0

Step-by-step explanation:

Find the sine of ∠D.

Write your answer as an integer or as a decimal rounded to the nearest hundredth.

Answers

We know

[tex]\\ \sf{:}\Rrightarrow sin\Theta=\dfrac{Perpendicular}{Hypotenuse}[/tex]

Now

[tex]\\ \sf{:}\Rrightarrow sinD=\dfrac{FE}{DE}[/tex]

[tex]\\ \sf{:}\Rrightarrow sinD=\dfrac{55}{73}[/tex]

Can you help me please ?

Answers

Answer:

A

Step-by-step explanation:

rise⇵ over run ⇄

the rise is -6 the run is 3

7/11 x 7/15 x 3 multiply and write your answer as a fraction in the simplest form.

Answers

Answer:  49/55  

7/11 x 7/15 x 3  

49/165 * 3  

147/165  

49/55

[tex]\dfrac{7}{11} \times \dfrac{7}{15} \times 3\\\\\\=\dfrac{7}{11} \times \dfrac{7}{3\times 5} \times 3\\\\\\=\dfrac{7}{11} \times \dfrac{7}{5}\\\\\\=\dfrac{7\times7}{11 \times 5}\\\\\\=\dfrac{49}{55}[/tex]

Other Questions
PLEASE HELPP!!!! Which process does osmosis involve?A. movement of solute up a concentration gradientB.movement of solute across the cell membraneC. movement of water across a cell membraneD. movement of water up a concentration gradient Observe the cell as it moves from stage to stage through cell division. What trends can you describe about the cell and its internal contents? Question 8 of 10The molecules that make up food contain energy. How does the human bodyget energy from the food molecules?A. By adding energy to the moleculesB. By breaking and reforming chemical bonds in the moleculesC. By using them to form ionic bondsD. By combining the molecules together A garden hose shoots water horizontally from the top of a tall building toward the wall of a second building 20 meters away. If the speed with which the water leaves the hose is 5 m/sec, how long does it take the water to reach the second building, and what distance does the water fall in this time? Understand how to work with negative bases and negative exponents.5^2 = 5^-2 = (-5)^2 = - 5^2 = (Remember to find the base, then multiply.) Does anyone know the answer for this question? I really need it. ______ is an example of a TCS food.A whole watermelonChickenBreadUncooked (dry) rice A piecewise function is represented by the graph below.On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line goes from (negative 5, 3) to (negative 1, negative 1) and then goes up to a closed circle at (1, 1). The second line has an open circle at (1, 2) and then continues up through (3, 4).What is the domain for the piece of the function represented by f(x) = x + 1?x < 11 x 11 x < 2x > 1 Termina cada conversacin para indicar que la segunda persona est de acuerdo con la primera. 8. Carolina: A m no me gusta limpiar (to clean) la casa. Miguel: A m ____________________________. Immersive Reader(1 Point)tambientampoco Exam GuidelinesExam InstructionsQuestion 4 of 20:Select the best answer for the question.4. Which of the following statements about writing introductions and conclusions is true?O A. Always write the body paragraphs and the conclusion before going back to write the introduction.B. If you have trouble beginning with the introduction, write the body paragraphs first.C. If you're writing a research paper, you don't need an introduction or a conclusion.D. Always write the introduction first and the conclusion last.Mark for review (Will be highlighted on the review page)> Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct Which of the following lines of a dialogue is most appropriate for a naturalist play A. Where are we going? What's happening? B. Does thou require a repast this morn?C. Hark, what light younder window breaks?D. Whither are we bond? At optimum light intensity, which atmospheric gas most directly influences the rate of photosynthesis? * Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)?