WHY IS IMPORTANT THAT WE CONTROL WHAT WE EAT ?

Answers

Answer 1
It is important that we control what we eat because food is an important source of energy for our bodies. We need to ensure that we have a balanced diet so we can have the energy we need and have a healthy body.
Answer 2

Answer:

By making better choices of the food we eat is better for our body and the way you act.

Explanation:

When you eat better you get energy from those foods. It also allows your nerves to be more calm and less stressed.


Related Questions

how long does it take for salmonella to make you sick?

Answers

Answer:

6hrs to 6 days

Explanation:

Symptoms usually start 6 hours to 6 days after infection. They include diarrhea that can be bloody, fever, and stomach cramps. Most people recover within 4 to 7 days without antibiotic treatment.

Answer: Salmonella Symptoms
Symptoms usually start 6 hours to 6 days after infection. They include diarrhea that can be bloody, fever, and stomach cramps. Most people recover within 4 to 7 days without antibiotic.

Paragraph: Food that is contaminated with Salmonella or other harmful germs usually looks, tastes, and smells normal. That’s why it’s important to know how to prevent infection.

Salmonella cause far more illnesses than you might suspect. For every case of Salmonella illness confirmed by laboratory tests, almost 30 other cases are not reported. That’s because most people with symptoms of foodborne illness do not go to the doctor or submit a sample to a laboratory, so we never learn what germ made them sick. CDC estimates that Salmonella cause more than 1 million foodborne illnesses in the United States every year.

What Can Cause Salmonella Infection?
You can get a Salmonella infection from a variety of foods, including chicken, turkey, beef, pork, eggs, fruits, sprouts, other vegetables, and even processed foods, such as nut butters, frozen pot pies, chicken nuggets, and stuffed chicken entrees. Some recent Salmonella outbreaks that sickened people in many states were linked to chicken, ground turkey, ground beef, raw tuna, mushrooms, onions, peaches, papayas, cut fruits, cashew brie, and tahini.

Food isn’t the only way Salmonella spread to people. The bacteria also spread through contaminated water, the environment, other people, and animals. Even pets and animals you might come into contact with at petting zoos, farms, fairs, and schools and daycares can carry Salmonella and other harmful germs. Get tips to help you stay safe around feathery, furry, and scaly friends.

Who Is More Likely to Get a Salmonella Infection?
Certain people are more likely to get a serious Salmonella infection. These people include children who are younger than 5, adults who are 65 and older, and people whose immune systems are weakened from certain medical conditions (such as diabetes, liver or kidney disease, and cancer) or their treatments.

Salmonella Symptoms
Salmonella illness can be serious. Symptoms usually start 6 hours to 6 days after infection. They include diarrhea that can be bloody, fever, and stomach cramps. Most people recover within 4 to 7 days without antibiotic treatment. But some people with severe diarrhea may need to be hospitalized or take antibiotics.

Call the doctor if you have:
Diarrhea and a fever higher than 102°F
Diarrhea for more than 3 days that is not improving
Bloody stools
Prolonged vomiting that prevents you from keeping liquids down
Signs of dehydration, such as:
Making very little urine
Dry mouth and throat
Dizziness when standing up

According to the three-second rule, what does it take drivers approximately three seconds to do?

Answers

Answer:

Simply leave 3 seconds worth of room between you and the vehicle you are following. Just watch the vehicle in front of you pass a road sign or other inanimate object on the side of the road and count out “One Massachusetts, Two Massachusetts, Three Massachusetts” before your vehicle passes that same object

help on this work please

Answers

Answer:

killer

Explanation:

Optimism is


a. the ability to recover from prolonged stress.
b. the tendency to focus on the positive aspects of a situation.
c. the tendency to focus on the negative aspects of a situation.
d. the tendency to accept nothing less than excellence.

Answers

I think that the answer is B.

how does eating food provide energy for humans khan

Answers

Answer:

[tex]\huge\purple{\overline{\quad\quad\quad\quad\quad\quad\quad\quad\quad \ \ \ }}[/tex]

Our bodies digest the food we eat by mixing it with fluids (acids and enzymes) in the stomach.

#CarryOnLearning

is it safe to use a vibrating massager during pregnancy

Answers

yes it is safe to use a vibrating massager during pregnancy

What are the causes of a curved spine?

need EVERY detail pls

Answers

Answer:

Stress on Back.

Explanation:

If you have curved, you might lean a little when you stand. You could also have:

A visible curve in your back

Shoulders, a waist, or hips that look uneven

One shoulder blade that looks bigger

Ribs that stick out farther on one side of your body than the other

In addition to visible symptoms, scoliosis may lead to:

Low back pain

Back stiffness

Pain and numbness in your legs (from pinched nerves)

Fatigue due to muscle strain

Answer:

There are several possible causes of a curved spine, also known as scoliosis. Some of the most common causes include:

1. Idiopathic scoliosis: This is the most common type of scoliosis, and it has no known cause. It usually develops during childhood or adolescence, and it can progress over time.

2. Congenital scoliosis: This type of scoliosis is present at birth and is caused by spinal abnormalities that occur during fetal development.

3. Neuromuscular scoliosis: This type of scoliosis is caused by neuromuscular disorders that affect the muscles and nerves that control the spine, such as cerebral palsy or muscular dystrophy.

4. Degenerative scoliosis: This type of scoliosis is caused by the degeneration of the spine due to aging, and it is more common in older adults.

5. Traumatic scoliosis: This type of scoliosis is caused by a spinal injury or trauma, such as a fracture or dislocation.

6. Functional scoliosis: This type of scoliosis is caused by an underlying problem, such as one leg being shorter than the other or muscle spasms, that causes the spine to curve.

The treatment for scoliosis depends on the severity of the curve and the underlying cause of the condition. Treatment options may include observation, bracing, physical therapy, and surgery in severe cases.

The lymphatic system is a system that


helps to prevent blood from circulating.


helps to fight disease and infection.


helps to destroy red blood cells.


helps to maintain body temperature.

Answers

Answer:

Explanation:

You can eliminate A and C. If these happen, the vital organs will not receive oxygen.

This really is not a super good question. The closest answer is to help fight disease and infection, but other things help do that as well.

Answer:

B

Explanation:

EDGE

Which of the following is NOT an effect of smoking

Answers

Answer:

can you give me the options to choose from?

If you want to eat vegetables with high levels of nutrients, you should look for vegetables that have .. A bright colors. B large seeds or pits. с a strong scent. D leaves and roots attached.​

Answers

Answer:

letter a is the answer

Explanation:

Look for colorful fruits and vegetables, especially orange and dark green. Choose these foods: Broccoli, cauliflower, and Brussels sprouts. Leafy greens, such as chard, cabbage, romaine, and bok choy.

HEY!

have a good day

thank me later

carryonlearing

Answer:

Answer: A

Explanation:

Heredity refers to the __________.
A.
removal of DNA from the human body
B.
formation of chromosomes from DNA
C.
many types of female genes
D.
passing of traits from parents to children

Answers

Answer:

the answer is probably D.

please im really please of this​

Answers

Answer:

activity 2 answers

i don't want to hurt my body

they get addicted fast due to constant peer pressure

i can help young people to know that it s ok to say no to peer pressure and start a club

Explanation:

bye

What was the most difficult part about the stress tests and picking the
combination of materials for the best smartphone case?

Answers

Answer:

A heart stress test is fairly safe. It simulates strenuous exercise, such as jogging or running up a flight stairs, so there are only minimal risks associated with a stress test, such as a change in blood pressure or abnormal heart rhythm.

determination of blood gases includes testing an arterial sample for

Answers

Answer: An arterial blood gases test or ABG is your answer.

An arterial blood gases (ABG) test measures the acidity (pH) and the levels of oxygen and carbon dioxide in the blood from an artery.

Which of the following is not a persuasive technique used in advertising?

Answers

Persuasive techniques in advertising are the measures that are used to convince customers to purchase a product. Some of the techniques used are ethos, pathos, and logos.

The options were not provided here.

But to help you identify the correct answer, you need to know that the several techniques used in advertising can appeal to logical reasoning (logos), the emotional feeling (pathos), and the credibility of the product being offered.

So, look through your options to identify the option that does not fall into any of these categories.

Learn more about persuasive techniques here:

https://brainly.com/question/1906545

how does physiological factors cause mental illness

Answers

Answer:

Explanation:

Mental illness itself occurs from the interaction of multiple genes and other factors -- such as stress, abuse, or a traumatic event -- which can influence, or trigger, an illness in a person who has an inherited susceptibility to i

TRue or false once you identify a person who is suicidal does asking more questions help most times

Answers

Answer:

sometimes depending on the status sometimes it would make them think you are pressuring them to answering but mostly try to get them help before it's too late

Explanation:

Answer:

It's true.............

in mythology, the sphinx has the head of a human and the body of a what?

Answers

Answer: The Sphinx was a mythical creature with the body of a lion and the head of a human, falcon, or ram. The Sphinx is found in both ancient Egyptian and Greek mythology.

Explanation:

marinades are acidic, which kills bacteria—so it’s ok to marinate foods on the counter.

Answers

Answer: No

Explanation: There could be viruses on the counter. It is important to marinate foods on disinfected areas, or in the cooking pan, pot, or slow cooker you are using.

in the third-party payment system, the patient is the

Answers

The answer is. First party.

In the third-party payment system, the patient is the first party .

What is the third party payment system?

A third-party payment processor is a provider that allows a business to accept payments without opening its own merchant account.

Who is considered third party?

A third party is someone who is not one of the main people involved in a business agreement or legal case, but who is involved in it in a minor role.

To learn more about third party  ,here

https://brainly.com/question/1620240?referrer=searchResults

#SPJ2

How can two people with the same disease have
different qualities of life?

Answers

Answer:

Where to begin...First off, an obvious answer would be what disease was being discussed. Different diseases can vary in intensity for a variety of reasons. For example, let's say person 1 found out about his infection long before person 2? Person one will most likely have fewer and much less symptoms then person 2, and in some illnesses, may even be able to treat it in early stages. Let's say, however, that the disease was the same disease at the same stage for two different people. Resources could obviously effect the quality of life both have. While someone with a disease may be able to recieve medical staff, vaccines and machines that may allow them to recover with no issues, someone in africa may simply have to take it with no or little medical equipment, ultimetly putting their life on the line. The final thing I will discuss that is probably the biggest factor, genetics. Some people have immune systems strong enough to fight pretty much anything, while others could pass away from a cold. This has a major effect on quality of life, as the people with strong immune systems will be able to pretty much walk away from a disease with very few complications, while someone with a very weak immune system could walk away with weakened hearts, hernias, and in some cases, fatality.

Sorry the explanation was so long, but I do hope it's helped! :)

list down the part of the human body​

Answers

Answer:

The brain. The brain is the control centre of the nervous system and is located within the skull. ...

The lungs. ...

The liver. ...

The bladder. ...

The kidneys. ...

The heart. ...

The stomach. ...

The intestines

Answer:

2

Explanation:

there are two parts of human body

1st: internal human body

2nd: external human body

Awnser this with a fun fact about yourself, and I will mark brainliest. ​

Answers

I was adopted when I was a baby

which bloodborne pathogen has the most chronic cases in the united states

Answers

Answer:

Hepatitis C is the most common bloodborne infection in the U.S. Approximately 3.6 million

Explanation:

Answer:

Hepatitis C is the most common bloodborne infection in the U.S. Approximately 3.6 million Cases

Explanation:

Lymphedema is common among individuals battling


mononucleosis.

fatigue.

lupus.

cancer.

Answers

Answer:

cancer

Explanation:

it is among individuals battling cancer

how does shivering help maintain stable internal conditions in the human body?

Answers

Answer: Shivering helps raise body temperature.

Explanation: Shivering - nerve impulses are sent by the hypothalamus to the skeletal muscles to bring about rapid contractions that generate heat. Shivering therefore helps raise the body temperature. Increase in metabolic rate - the liver produces extra heat in order to raise the temperature of the body

the kinds of motion your movable joints allow.

Answers

Answer:

Slide past each other or to rotate around each other

Explanation:

Stress affects which parts of one’s body?

Answers

Answer:

Musculoskeletal System: Muscles tense as a reflex reaction to stress. Chronic stress can lead to tension and migraine...

Respiratory System: Stress causes you to breathe harder, and getting oxygen can become difficult if you have a lung...

Cardiovascular System: Acute stress increases heart rate

Explanation:

Answer:

All of them really, but mostly heart and brain

Explanation:

Find the low and high target heart rate zones for a 46-year-old teacher from El Cerrito Middle School with a resting heart rate of 78bpm.

Answers

The low and high target heart rate zones for the 46-year-old teacher with a resting heart rate of 78bpm are;

Low target heart rate = 87 bpm

High target heart rate = 131 bpm

We are told that the resting heart rate of the 46 year old teacher is 78 bpm.

Now, the formula for calculation of the estimated maximum age-related heart rate is;

Maximum age related heart rate = 220 – person's age

For this 46 year old man;

Maximum age related heart rate = 220 - 46

Maximum age related heart rate = 174 bpm

Now. since his resting heart rate is average at 78 bpm, then the low and high target heart rate will be gotten from the formula;

Low target heart rate = 50% × Maximum age related heart rate

High target heart rate = 75% × Maximum age related heart rate

Thus;

Low target heart rate = 50% × 174

Low target heart rate = 87 bpm

High target heart rate = 75% × 174

High target heart rate ≈ 131 bpm

Read more about target heart rate at; https://brainly.com/question/770092

If someone has been let go from their job but exhibits a high-level of hardiness, how might he or she respond?

Answers

Self commit die. That’s the answe
Other Questions
32) 48,504 16 33) Is the sum of 15,398 + 7,292 even or odd? Why? 34) Is the product of 312,234 x 8,987 even or odd? Why? I need all of these answers by today!! Pls help right answer gets brainliest A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD