which term describes the site of a muscle attaching to the bone that moves the most?

Answers

Answer 1

Answer:

Insertion

Explanation:


Related Questions

Which of the following are the two principal end products of photosynthesis? (4 points)
a) Glycogen and starch
b) Glycogen and cellulose
c) Starch and glycerol
d) Starch and glucose

Please help me with the answer, tysm!

Answers

Answer:

Starch and Glucose

Explanation:

Hope this helps

Answer:

The end products of photosynthesis are glucose and oxygen. None of those answers are right..

Explanation:

a scientist finds an organism that has a single cell without a nucleus this organism was found in pond water in which kingdom does it belong to? explain what is the answer if you find the answer i will give you 100,000 dollars

Answers

Answer:

Protista

Explanation:

In biology, there are said to be six different kingdoms that an organism can be classified under. They include Animalia, Plantae, Fungi, Protista, Archaea/Archaebacteria, and Bacteria/Eubacteria.

With this in mind, you say that a unicellular (single-celled) organism without a nucleus was found in pond water. This would point to the Protista kingdom, which are also known as protists. These organisms are single-celled beings with no big nucleus that are typically found in environments like ponds.

Hope this helped! I will take my 100,000 dollars via wire transfer (or just give this answer branliest)

in all organisms, certain genes are expressed at any given time while other genes are not. both prokaryotes and eukaryotes regulate gene expression at the transcription stage. however, the greater complexity of eukaryotic cells makes it possible for gene expression to be regulated at many other stages as well. the diagram below shows different stages at which gene expression may be regulated in eukaryotes.

Answers

Answer:

The process of turning genes on and off is known as gene regulation. Gene regulation is an important part of normal development. Genes are turned on and off in different patterns during development to make a brain cell look and act different from a liver cell or a muscle cell, for examp

How does a forest fire impact a population of birds that nest in the trees.

Answers

Answer:

If a forest fire occurs it will impact a population of birds that nest in those trees because their habitat will be burnt down. This will provoke the birds to find a new habitat which can be hard if the entire forest is burnt down. Additionally resources such as food will be burned down as well.

Assuming birds escape a fire, smoke might still affect their health in ways that aren’t very well understood. Scientists have found that smoke can damage lung tissue and leave the animals susceptible to potentially lethal respiratory infections.

What do we call it when trees and
crops are interplanted?
A. industrial agriculture
B. terracing
C. irrigation
D. agroforestry

Answers

Answer:

D. agroforestry

who was the first person to study the embryos of different species

Answers

Answer:

Aristotle

Explanation:

Aristotle was the first person to study the embryos of different species.

Bob has brown hair and Sally has blonde hair. If brown hair is dominant and blonde hair is recessive, is it possible for Bob and Sally to have a blonde-haired child? Use the GENOTYPE of each parent to EXPLAIN your answer.

Answers

Answer:

no it is not possible

Explanation:

bc when you do a punnett square brown hair is dominant so there is not a possible way for their child to have blonde.

yes it is, let’s say B - is for brown hair and b - is for blonde hair
to have blonde hair they would have to have a bb genotype meaning that if bob had the Bb genotype then sally and bob have a 1/4th chance of having a blonde haired child

11. Approximately how much of Earth's fresh water is trapped in glacial ice?
O A. 70 percent
OB. 10 percent
O C.30 percent
O D. 90 percent

Answers

Answer:

A. 70 percent

5. One reason that viruses are harmful to living cells and classified as pathogens is that they-
A cause organisms to produce daughter cells through the process of mitosis
B stimulate the production of ATP in mitochondria within host cells
C damage the cells used in the production of new virus particles
Dreduce the amount of cholesterol in the blood of people with heart disease

Answers

The answer is b. Just took the test

what virus cycle causes immediate infection

Answers

Answer:

the lysogenic cycle does not result in immediate lysing of the host cell

what happens when a vacuole releases its store of water?

Answers

If the central vacuole in plants cell loses its water then the plant will plasmolyse or deflate.

3. Hydrogen peroxide is used as an antiseptic to kill bacteria in cuts and abrasions. Many of these are catalase positive, yet they are still killed by the actions of hydrogen peroxide. Why does this occur

Answers

Answer: Hydrogen peroxide is used as an antiseptic to kill bacteria in cuts and abrasions. Many of these bacteria are catalase positive,

Explanation: that’s it

Organ system:Put the following in order from smallest to largest:
Cells
Organs
Tissues

Answers

Cells, tissues, organs

Answer:

Cell, Tissue, Organ

Explanation:

help me pls ASAP it's need​

Answers

Answer:

4. true 5. true 6. false 7. A

what are all the decomposers in the ocean?

Answers

Answer:

crustaceans and mollusks, bacteria, fungi, sea cucumbers, starfish, sea urchins, and other kinds of marine worms.

Explanation:

Overall, the main decomposer organisms in marine ecosystems are bacteria. Other important decomposers are fungi, marine worms, echinoderms, crustaceans and mollusks. In the colder ocean waters, only bacteria and fungi do the decomposing because the other creatures cannot survive in the extreme condition

What dating technique could scientist use to find the age of a meteoroid?

Answers

Answer:  isochron method.

Explanation:

5. Drug X blocks ATP regeneration from ADP and phosphate. How will muscle cells respond to this drug?
A. by absorbing ATP from the bloodstream
B. by using ADP as an energy source
C. by using glycogen as an energy source
D. none of the above

Answers

The answer is: D - none of the above.

The muscle would contract with isotonic force. The muscle would contract isometrically. As a result of the actin-myosin cross bridges' inability to persist, the muscle would relax and lengthen. Thus, option D is correct.

What is effect of drug on ATP inhibition?

Efrapeptins and aurovertins, two types of antibiotics, prevent ATP synthase from producing or breaking down ATP.

The rotor, the core cavity of the enzyme, and the particular -subunit catalytic site are where the efrapeptins bind to ATP synthase. This is because there won't be an ATP synthase-driven proton gradient.

The inability of the inner mitochondrial membrane to remain impermeable to protons or the cessation of electron transport will prevent oxidative phosphorylation from taking place.

Therefore, muscle contract with isotonic force.

Learn more about  ATP inhibition here:

https://brainly.com/question/1906658

#SPJ2

Zander is conducting an investigation, and he used this video. Which statement best describes what Zander is testing in his experiment?





When a substance changes from a gas into a liquid due to a change in temperature, melting occurs, which is a physical change.


When a substance changes from a solid into a liquid due to an increase in temperature, it is a physical change.


When a substance changes from a gas into a liquid due to a decrease in temperature, the substance cools down and condenses, which is a phase change.


When a substance changes from a liquid into a gas due to a decrease in temperature, the substance evaporates and cools down, which is a phase change.

Answers

Answer:

sorry it is c

Explanation:

which explanations accurately describe how cell structures interact in order to maintain homeostasis? select all that apply.

Answers

Answer:

Maintaining homeostasis requires that the body continuously monitors its internal conditions. From body temperature to blood pressure to levels of certain nutrients, each physiological condition has a particular set point. A set point is the physiological value around which the normal range fluctuates.

Explanation:

Which food would be best for a child who has weak teeth and bones? (according to the table)
Food: ________
Explanation: _____________________________________________________________________________________________________________________________________________________________________________________________________________

Answers

Answer:

Milk

Explanation:

It contains High calcium which will help to strengthen the teeth and bones of said child

milk because of the benefits from calcium

plant cell don't burst when placed in water because?​

Answers

Answer:

it absorbs the water

Explanation:

what processes in your cells produce the co2 that you exhale?

Answers

Answer:

Co2 is released from the pyruvate that is formed during glycolysis, and CO2 is also released during the citric acid cycle.

Explanation:

Cellular respiration in mitochondria produces [tex]CO_2[/tex] as a waste product, exhaled during breathing.

Cellular respiration occurs mostly in mitochondria. During cellular respiration, glucose and other nutrients are broken down to make ATP. This procedure produces [tex]CO_2[/tex]. [tex]CO_2[/tex] from mitochondria diffuses into the circulation.

Breathing exchanges [tex]CO_2[/tex] for oxygen in the lungs from the circulation. Your body releases [tex]CO_2[/tex] when you exhale. This important cycle eliminates unwanted [tex]CO_2[/tex] and supplies cells with oxygen for respiration and energy generation.

Learn more about cellular respiration, here:

https://brainly.com/question/32872970

#SPJ3

How do you think astronomers group planets?

Answers

Answer:

They group them biased off of similar traits and there orbital paths.

Explanation:

I hope this helped ^ ^

Which animals male reproductive organ is actually one of its arms?

Answers

I believe it’s an octopus
a hectocotylus hope this helps

John and Marissa purchase their first home for $120,000. They must put 15 percent down on the purchase price as a down payment. What will the amount of the down payment be?

Answers

Answer:

Downpayment: 15% of original price

Original price: $120,000

15% of 120,000 = [tex]\frac{15}{100}[/tex] × 120,000

                          = $18,000

Thus, the downpayment is $18,000.

John and Marissa purchase their first home for $120,000 than the Down payment is 15% of original price

Original price: $120,000

15% of 120,000 =  × 12 = $18,000

Thus, the downpayment is $18,000.

What is down payment?

Part A

The down payment of $48,000 is 20% of the purchase price

Part B

A $12,000 down payment will be 5% of the purchase price

A percentage is the expression of the product of the ratio of two numbers and 100

The amount the investors buy the studio apartment = $240,000

The amount the investors have as down payment = $48,000

Part A

The ratio of the down payment the investors have and the amount the investors buy the apartment = 45,000/240,00 = 0.2

Therefore, their down payment is 0.2×100 = 20% percentage of their purchase price

Their $48,000 down payment is 20% of their purchase price

Part B

The percentage of the purchase price a $12,000 down payment would be is given as follows;

12,000/240,000 × 100 = 5%

Therefore, a $12,000 down payment will be 5% of the purchase price.

John and Marissa purchase their first home for $120,000 than the Down payment is 15% of original price

Original price: $120,000

15% of 120,000 =  × 12 = $18,000

Thus, the down payment is $18,000.

Learn more about down payment on:

https://brainly.com/question/29397199

#SPJ5

The Chromosomes separate & move AWAY
from each other towards the POLES of
the cell during:

Cytokinesis

Telophase

Anaphase

Prophase

Metaphase

Please answer I’d appreciate it a lot

Answers

Answer:

These phases are prophase, prometaphase, metaphase, anaphase, and telophase.

Explanation:

Answer:

Anaphase

Explanation:

Anaphase is when the sister chromosomes seperate towards the poles of the spindle.

Leaves appear green because the green portion of the light that strikes them out is

Answers

Answer:

reflected

Explanation:

Whatever color your eye sees is the reflected light. So all colors absorbed.

in _________, enzymes cut DNA into fragments, which are separated by size to form a pattern of bands.

a. selective breeding
b. cloning
c. dna fingerprinting
d. protein synthesis

Answers

Restriction enzyme analysis

refer to vs map: gene expression—flow of information from gene to protein tour. which base pairing is incorrect?

Answers

I think your question is lacking

a main advantage to organisms that reproduce sexually is

Answers

Answer:

During sexual reproduction, the genetic material of two individuals is combined to produce genetically-diverse offspring that differ from their parents. ... The genetic diversity of sexually-produced offspring is thought to give species a better chance of surviving in an unpredictable or changing environment.

_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

Hope this helps :)

Other Questions
(PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95? According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month? can hellp me with this plzzzzzzz no links plz how are continental climates different from temperate climates Which word from Juliet's conversation with her mother is understood oneway by Lady Capulet and another way by the audience?A. CousinB. HeartC. TemperD. Love When corn is to be planted by the Indians, it is the work of the women folk to see to the sorting and cleaning of the best seed. It is also the women's work to see to the planting. (This was in olden times.)After the best seed has been selected, the planter measures the corn, lays down a layer of hay, then a layer of corn. Over this corn they sprinkle warm water and cover it with another layer of hay, then bind hay about the bundle and hang it up in a spot where the warm rays of the sun can strike it. While the corn is hanging in the sun, the ground is being prepared to receive it. Having finished the task of preparing the ground, the woman takes down her seed corn, which has by this time sprouted. Then she proceeds to plant the corn. Before she plants the first hill, she extends her heavenwards and asks the Great Spirit to bless her work, that she may have a good yield. After her prayer she takes four kernels and plants one at the north, one at the south, one at the east and one at the west sides of the first hill. This is asking the Great Spirit to give summer rain and sunshine to bring forth a good crop. For different growths of the corn, the women have an interpretation as to the character of the one who planted it.1st. Where the corn grows in straight rows and the cob is full of kernels to the end, this signifies that the planter of this corn is of an exemplary character, and is very truthful and thoughtful.2nd. If the rows on the ears of corn are irregular and broken, the planter is considered careless and unthoughtful. Also disorderly and slovenly about her house and person.3rd. When an ear of corn bears a few scattering kernels with spaces producing no corn, it is said that is a good sign that the planter will live to a ripe old age. So old will they be that like the corn, their teeth will be few and far between.4th. When a stalk bears a great many nubbins, or small ears growing around the large one, it is a sign that the planter is from a large and respectable family.After the corn is gathered, it is boiled into sweet corn and made into hominy; parched and mixed with buffalo tallow and rolled into round balls, and used at feasts, or carried by the warriors on the warpath as food. When there has been a good crop of corn, an ear is always tied at the top of the medicine pole, of the sun dance, in thanks to the Great Spirit for his goodness to them in sending a bountiful crop.Required:In one to two sentences, explain what the reaction of the Sioux to a good crop shows about the Sioux people. 1) 0.52 + 1.6 + 8.26 =2) 1.4 + 5.98 + 9 + 0.39 =3) 4.45 + 7 + 0.049 =4) 12.54 1. 054 =5) 0. 685 0. 5903 =6) (34. 89) (0.875) =7) (840) (0.625) =8) 28.5 0.87 =9) 104 6.4 = how does one make a plush design for a character with floating limbs metabolism is the chemical process your body uses to breakdown and transform food Help help help help help A number is chosen uniformly at random from among the positive integers less than $10^8$. Given that the sum of the digits of the number is 9, what is the probability that the number is prime Plays tell stories and have characters with conflict. They are written:to be performed on stageto be read silentlyto be ignoredall of the above the study of heritability of behavioral traits is called