which of the following words is a synonym for morph

Answers

Answer 1

Answer:

change, alter, etc

Explanation:

Answer 2

Answer:

Some synonyms of morph are.

Alter, modify, transform, contort, distort, deform, doctor, mutate, recast, transmute, wring.


Related Questions

How does Obama use rhetoric in paragraph 6 to advance his point of view?

Answers

Answer:

To dispel the fears of some white Americans and to advance his chances for election, Obama delivered a major address on race in America, a speech that was praised even by some of his adversaries. Obama had/has a gift for language. He is a skilled orator. To neutralize that advantage, his opponents – including Hillary Clinton at one point – would characterize Obama’s words as empty “rhetoric” – an elaborate trick of language.

Explanation:

Had to do this last week

Do you agree with the father that school is not a punishment, but a factory that develops boys onto productive men? Why or why not?

please help me..i need answer asap​

Answers

Answer:

Like the father, I do agree that school is not a punishment, but rather a factory that develops the boy into a productive man. Education is what allows students to grow and nurture their talents, preparing them to become working members of the society in the future. With this, we may conclude that schools are what mold us into people who will soon be able to be productive citizens, as we contribute to the betterment of our society.

Carry learning!

Study hard!

Stay safe!

Brainliest if you want!

6. I took them ___ hours to clean the. court.
7. ___people are jobless because of the pandemic.
8. Do not live yet and wait for ___ name to be called.
9. We don't have ___ choice but to accept what happened.
10. We should take good care of ___ parents even if they are already old. ​

Answers

Answer:

1. few

2. some

3. any

4. one

5. every

6. many

7. several

8. your

9. much

10. our

Explanation:

hope this helps! should be correct.

Read the excerpt from a formal letter.

The woods behind the high school have become littered with trash. The students at the school are partly responsible for the problem. We are often careless with our trash when we are in the schoolyard. Since we helped make the mess, we should organize a clean-up day.

Which sentence from the paragraph best identifies the letter’s purpose?

The woods behind the high school have become littered with trash.
As students at the school, we are partly responsible for the problem.
We are often careless with our trash when we are in the schoolyard.
Since we helped make the mess, we should organize a clean-up day.

Answers

Answer:

D) Since we helped make the mess, we should organize a clean-up day.

Explanation:

It's a truth that this holds true all across the globe. In any case, this is the letter's central purpose.

Answer:

d

Explanation:

What are ways in which social expectations are different amongst young people and senior citizens in your culture or family? How is each person in the relationship expected to act? What is common for one generation but not the other?

Answers

Answer:

Our family basically has cookouts and stuff. It's common for all our family's generation. We usually act grateful.

Explanation:

Answer: I would say that social expectations for younger generations are completely different compared to those who are older and here's why, young-ish people (such as Millennials and Gen X) are typically polite, kind, genuine and use manners while anyone in the category of Gen Z doesn't even shake hands anymore when they meet someone (at least that's what I've seen) and sometimes aren't very kind or polite to others, especially their peers. I'm part of Gen Z (16) and I have been taking note on how teens my age introduce themselves or greet someone. It's kind of concerning because many of them don't understand simple morals-

I feel like some common traits that Gen X and Millennials share that us, Gen Z doesn't, is patience, follow-through and just the ability to be in the moment. My parents are so good at controlling themselves from doing other things, they can just sit and be present now. Unlike us, always have to be on our phones or gaming. It's crazy. Sometimes I'm jealous of the older generations because they seem like they've got everything together.   wowww uhmmm im sorry- this is a lot...

hope it helped tho :>

Please help me with this discussion, if you can write something about Russia culture that would be perfect, but you don't have to​

Answers

Answer:Family is Priority

Explanation:

PLEASE HELP ME!
NO LINKS PLEASE!
Why most likely does Reagan’s make a comparison to “explorers” in the following passage (paragraph 8, Moscow State University Address)?

The explorers of the modern era are the entrepreneurs, men with vision, with the courage to take risks and faith enough to brave the unknown. These entrepreneurs and their small enterprises are responsible for almost all the economic growth in the United States. They are the prime movers of the technological revolution.
A)

He is warning the students that the future entrepreneurs will face limits the same way explorers did.


B)

He is encouraging the students to be risk takers in the future, and embrace failure as explorers did.


C)

He is applauding the students for finding their paths to college with a courage similar to explorers.


D)

He is suggesting that the students may have to venture outside their home country to be successful in the new age.

Answers

Answer:

d

Explanation:

its d

Reagan’s make a comparison to “explorers” because of option B: he is encouraging the students to be risk takers in the future, and embrace failure as explorers did.

Why most likely does Reagan’s make a comparison to “explorers”?

Reagan starts establishing new political and economic initiatives in his early days. His supply-side economics policies helpful for advocated tax reduction, economic deregulation, and reduction in government expenses.

During his speech, he respected the hard work and productivity of the explorers. His gave emphasizes on the contribution to the economic and physical growth of the America.

While giving the speech, Reagan’s aruge the students to take the risks in order to get the succes in the life like the explorers did in their past times. He shared part of the history of the United States and the way America lived its principles.

He admired that every person have their own particular objects and vision that they want to achieve in any cost. Their enterprises are responsible for the overall growth of nation.

Therefore, correct option is B.

Learn more about Reagan, refer to the link:

https://brainly.com/question/4784629

#SPJ2

What summary would you give me for the chocolate touch?

Answers

The Chocolate Touch is the story of a boy who truly learns to think less about himself and more about others. He loves candy, particularly chocolate, and his parents beg him to eat more healthily, but he pays them no mind. One day, he purchases the most delicious piece of chocolate he has ever eaten from a mysterious candy shop, and the next day discovers that everything that touches his mouth turns to chocolate. At first he is thrilled, but then realizes that he cannot eat food, drink water, or even play his trumpet without it all turning to chocolate, and he begins to wish to turn back to normal. This wish grows more intense when he kisses his mother and turns her to chocolate. Horrified at what he has done to her, he rushes back to the candy store he bought that fateful chocolate from and selflessly offers to suffer from his “chocolate touch” forever in exchange for the restoration of his mother. The owner of the shop tells him that he has learned his lesson of selflessness and that his mother will be back to normal and his “chocolate touch” will be cured. When he leaves the shop, it disappears, perplexing him, but thoughts of his mother dominate his mind, and he hurries back to his house. Back at home, everything returns to normal, with one minor difference: our main character eats far more balanced meals than before and thinks more about others. In conclusion, in The Chocolate Touch, a boy learns an important lesson of selflessness after a strange ailment forces him to consider others more thoughtfully.

simple and progressive tenses

Answers

Answer:

The simple tenses are used for actions that occurred at a specific time either in the present, past or future, but they do not state whether or not the action is finished. They are present (simple), past (simple) and future (simple). The progressive tenses are used to indicate an unfinished action.

Explanation:

How was Lohitai involved in the conflict in South Sudan?

Answers

Answer:

Spurred on by power struggles between the nation's leaders, the South Sudan conflict came to a head in 2013 when unresolved tensions between ethnic groups erupted into fighting that spread all over the country.Explanation:

PLS RATE MY PARAGRAPH

Many of the qualities that make being a human being fantastic have been eradicated in the community. Chapter 2: “The Ceremony for the Ones was always noisy and fun. Each December, all the new children born in the previous year turned One. One at a time—there were always fifty in each year’s group, if none had been released—they had been brought to the stage by the Nurturers who had cared for them since birth. Some were already walking, wobbly on their unsteady legs; others were no more than a few days old, wrapped in blankets, held by their Nurturers.” The ceremony is a naming for an infant. The birthgiver of the child does not get to name the child nor does she raise it. It's merely her job to give birth, a job she was assigned. “If you enjoy the little ones so much, you should hope for an Assignment as Nurturer.” “When you’re an Eight and start your volunteer hours, you can try some at the Nurturing Center,” Mother suggested.” People in this community are assigned employment based on their volunteer activities and whether or not their elders believe they will be good at the job.

Answers

Answer: argument, informative, and narrative writing

Explanation:

PLEASE HELP ME ASAP!
NO LINKS PLEASE!!!
(the immortal life of Henrietta locks)
Which inference about Henrietta Lacks’s role in medical science is best supported by the excerpt?

Question 7 options:

A)

Henrietta Lacks’s doctors created diagrams about her role in science.


B)

Newspapers published a great deal of material about Henrietta Lacks’s role.


C)

Most people were unaware of Henrietta Lacks’s role in science.


D)

Henrietta Lacks’s family maintained detailed records of her role.

Answers

Answer:

I believe it is C, cuz her family had no idea about the HeLa cells and the newspapers did not publish anything about Henrietta's role. Also, it wouldn't be A cuz they didn't give her any credit

Explanation:

Henrietta Lacks’s doctors created diagrams about her role in science is best supported by the excerpt. Thus, option A is correct.

What is an excerpt?

"An excerpt can be defined as a small paragraph that can be taken from a book, novel, or a poem, or even an article which describes what the person is intending to tell or show the readers about the message."

In the immortal life of Henrietta locks depicted that Lacks’s role is presented with the help of medical science. it depends upon how the diagram is created and how the signs are held to people in upliftment as well as this is the best decision that is taken or supported in this excerpt.

The first everlasting individual cells to be generated in cultivation were from Henrietta Lacks. They proved crucial in the creation of the polio vaccine. Inside the early space flights, they climbed up to investigate what'd react on cells in weightlessness.

Therefore, option A is the correct option.

Learn more about excerpt , here:

https://brainly.com/question/16553806

#SPJ2

F. Choose the pronoun that correctly completes the sentence. Is this homework mine or
?
she
hers
her

Answers

Answer:

Hers

Explanation:

It was a(n)situation

Answers

Answer:

The answer to your question is "It was a solution."

Explanation:

You would only use "an" if it was before a word that starts with a vowel.

Ex.

Wrong: "You'll find that he is a underdog when it comes to speaking."

Right: "You'll find that he is an underdog when it comes to speaking."

which type of fragrance language is being used in the example we had to tip toe around the house so we didn't wake up sleeping beauty

Answers

Answer:

The answer is allusion

Explanation:

its the allusion of a “sleeping beauty“ there

Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wish—whatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gain—not what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can have negative consequences.

Answers

Answer: "I tried to make him see the err of his choice, / but he would not heed the caution in my voice." (Lines 4–5)

Explanation: According to the poem "Bacchus's Regret", by Hunter Doyle, the speaker makes reference to how he intended to warn King Midas of the adverse outcome of his wish to turn everything he touched into gold. However, he mentions that Midas refused to listen to the his advice on the unpleasant result of his choice.

The border shown on the map was jagged and _____

Answers

Answer:

unprofessional

Explanation:

Bad bad bad bad bad not good

summary of 'cat' poem which is written by Eleanor farjeon​

Answers

Answer:

Hey mate!

Explanation:

Eleanor Farjeon's poem "Cat!" can be described as a shape poem. ... The poem speaks to the daily life of a typical cat. Through analysis, one can assume that the narrator has come in contact with a cat she (assumed given the gender of the poet) does not wish around.

pls mark me as brainliest!!

can anyone tell me a 5 sentence summary about alexander hamilton in the musical?

Answers

Answer:

The sense that everyone has a history and a legacy is what drives the characters' ethical lives, and encourages them to work for what they believe in. This theme is echoed time and again in an oft-uttered mantra of Hamilton's, "I'm not throwing away my shot"—his shot being his one chance at creating a dazzling legacy. Hamilton: An American Musical is a sung-and-rapped-through musical by Lin-Manuel Miranda. It tells the story of American Founding Father Alexander Hamilton. ... It casts non-white actors as the Founding Fathers and other historical figures. Miranda described Hamilton as about "America then, as told by America now".

Explanation:

Hope this helps

May I get braineist pls?

Answer:

I will say now that I got alittle help from someone on Quora

The musical is a biography of Alexander Hamilton, based on Ron Chernow’s non-fiction biography.Hamilton was an immigrant to New York from the Caribbean, a Revolutionary War veteran and George Washington’s aide de camp who eventually became the first Treasury secretary. Because he was illegitimate and came from poverty, he’s considered a symbol of the “self-made man” in America. He was also self-destructive and self-defeating in many ways. His political philosophy was in contrast to that of Thomas Jefferson (among others), who favored a more agrarian economy and wanted more power given to state-level governments. You might call it an urban vs. rural divide, with Hamilton the quintessential New Yorker and Jefferson the Virginia plantation baron. The musical, in rough chronological order, features the following hallmarks of Hamilton’s life (parallel songs in the parenthetical).

Explanation:

Read the excerpt below and answer the question.

She was by trade a weaver; and by constant application to her business, she had been in a good degree preserved from the blighting and dehumanizing effects of slavery. I was utterly astonished at her goodness.

What can be inferred from Douglass's describing his new mistress as "preserved from the blighting and dehumanizing effects of slavery" in this excerpt from Narrative of the Life of Frederick Douglass, An American Slave? Select all that apply.

A. He was young and still easily astonished.

B. Her goodness made her unique compared to most slave owners.

C. Slavery had a dehumanizing effect on slave owners as well.

D. Most slave owners did not apply themselves enough to their businesses.

Answers

Answer:

Her goodness made her unique compared to most slave owners .

The correct answer is option B. Her goodness made her unique compared to most slave owners.

Frederick Douglass's Life Story What are the main ideas of American slaves?

The Douglas story shows how white slave owners perpetuate slavery by keeping them ignorant. At the time Douglas wrote, many believed that slavery was a natural condition.

Frederick Douglass's life story is a story written by a former abolitionist. Like Uncle Tom's hut, it shows the inhumane effect of slavery on both masters and slaves.

Frederick Douglass's story is about slavery. From the colonial era to the end of the Civil War, it is a sneaky practice of owning people who were legal in the United States. Knowing that slavery existed as an abstract concept is one thing, and explaining it directly is another.

Learn more about Frederick Douglass's Narrative here: https://brainly.com/question/16024772

#SPJ2

Which example of dialogue is punctuated correctly?

“Be careful, because the floor is wet,” he warned.
“Be careful, because the floor is wet”, he warned.
“Be careful, because the floor is wet” he warned.
“Be careful, because the floor is wet.” he warned.

Answers

The 4th one

Explanation

He is done talking.

Absolute governments (tho’ the disgrace of human nature) have this advantage with them, that they are simple; if the people suffer, they know the head from which their suffering springs, know likewise the remedy, and are not bewildered by a variety of causes and cures. But the constitution of , , some will say in one and some in another, and every political physician will advise a different medicine.

Is this bolded phrase objective or subjective?

A.) neither object nor subjective
B.) subjective
C.) objective
D.) there is not enough information to tell

Answers

Answer:

subjective

Explanation: persuading reader

Answer: A or B

Explanation:

i might be wrong i if am so sorry

The word “fat” often carries a negative connotation. Write a story or observation where something fat is celebrated.
word count at least 125 words

Answers

Answer:

fat is celebrated when someone gets pregnant. this is because when you want to have a baby and do the things to get a baby whether its freezing an egg or doing the other thing, you get pregnant with a big belly to hold your baby so it can grow. with the belly growing bigger in the 9 months, you have a baby shower for the baby because you are pregnant. some may say ''fat''. but you get celebrated in a baby shower because your baby is in your stomach and they bring gifts for your baby before its born. the reason this is considered fat is because your baby is growing inside of you so your stomach swells up so it can help your baby grow and move around a little.fat is celebrated when you are pregnant .

Explanation:

PLS ANSWER THIS QUESTION THANKS NONSENSE WILL BE AUTO REPORTED ⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️​

Answers

Answer:

2. Ally

3. Live

4. Thankful

5. Happy

6. comfort

7. forgiveness

8. Relief

9. *I donno sorry :( *

10. Repair

Explanation:


Isaac wants to know how companies can implement fitness programs within their company guidelines for their employees

Answers

Sticking to a regular exercise schedule isn't easy. Get tips for overcoming common barriers.

(1) Most Americans know that “Uncle Sam” is a nickname for the United States; however, few Americans know how the name originated. (2) Some historians believe the name comes from a nineteenth-century businessman from New York. (3) His real name was Samuel Wilson. (4) His neighbors called him Uncle Sam. (5) During the War of 1812, he won a government contract. (6) He was to supply beef to U.S. soldiers. (7) The beef was packed in barrels labeled “U.S.” to show that they belonged to the U.S. government. (8) Soldiers from New York saw the barrels. (9) They jokingly said “U.S.” stood for Uncle Sam Wilson. (10) The joke spread. (11) Soon, soldiers began using the nickname Uncle Sam to refer to the United States. (12) Civilians also began using the nickname Uncle Sam to refer to the United States. (13) In 1961, Congress recognized Samuel Wilson. (14) It passed a resolution honoring him as the original Uncle Sam. Which is the most effective way to combine sentences (11) and (12)?

Answers

Answer:

Soon, soldiers and civilians began using the nickname Uncle Sam to refer to the United States.

Explanation:

Sentences 11 and 12 are both talking about "using the nickname Uncle Sam to refer to the United States".

In sentence 11, it talks about soldiers. In sentence 12, it talks about civilians.

You can say:

Soon, soldiers and civilians began using the nickname Uncle Sam to refer to the United States.

I think you...... eat vegetable. It is good for health

Answers

Answer:

Pizza

Explanation:

I will eat pizza thank u very much.

Should
.............

You have read the short story Raymond’s Run by Toni Cade Bambara. Think about the conflicts that occur in the plot of the story. Write an essay with 5 pargraphs that analyzes how the narrator changes as a result of the conflicts. Be sure to support your response with evidence from the text.

Answers

Answer:

 Have you ever decided what you needed to change? In the text “Raymond’s Run” by Toni Cade Bambara the narrator changes as a result of conflicts. In the beginning the narrator shifts from being egocentric by only caring if she won the race, to not caring if she won at all, then she went from only minding her brother, to coaching him how to run, and lastly she went from disliking Gretchen to having respect for her.

There are many changes throughout this story, one of them is how Squeaky shifts from only talking about and only caring if she won the race and beating Gretchen. As a result she did not care at all and was just thinking about how Roman kept up with her and thinking about how great of a runner he is, can, and will be. This was said in paragraph 3 “There is no track meet that I don’t win the first place medal.” I used to win the twenty-yard dash when I was a little kid in kindergarten.” This is an example of 1 change in the story.

 Another thing is that she watched her brother and was literally a part of him, but now she coaches him how to run. I know this because it says in Paragraph 240 “I can always retire as a runner and begin a whole new career as a coach with Raymond as my champion."And she isn't so worried about herself anymore. This shows how much she improved throughout the story and where she came from and where she is now. Considering that she only wanted to be the fastest and only cared if she won the May Day race. This is an example of 2 changes in the story.

Lastly, she went from heavily disliking Gretchen and absolutely despising her. You can hear by the way she talks about Gretchen and her friends in Paragraph 70-80. But going on towards the end after the race, she gained respect for Gretchen. And I know this because in paragraph 250 - 260 she said ”Maybe she’d like to help me coach Raymond; she obviously is serious about running, as any fool can see. And she nods to congratulate me and then she smiles. And I smile. We stand there with this big smile of respect between us. It’s about as real a smile as girls can do for each other, considering we don’t practice real smiling every day, you know, cause maybe we too busy being flowers or fairies or strawberries instead of something honest and worthy of respect . . . you know . . . like being people.” This shows that she changed many things just to resolve her conflicts. This is the 3rd change in the story.

Explanation:

...I only did 4 my bad.

Eraser Tattoo by Jason Reynolds:


The setting is significant to this story. It is a character in itself.

Describe the Brooklyn neighborhood that Shay and Dante

live in. In what ways are they "witnessing the neighborhood

rearrange itself "? (p. 5)

Answers

The setting is significant to the story, as a living element that influences the characters' behavior. Shay and Sante saw Brooklyn reorganizing because it has seen many changes during the years they have been there.

We can arrive at this answer because:

"Eraser Tattoo" is the story of two friends, Shay and Dante, who love each other but need to break up for Shay to follow her dreams.Even though the parting between them is sad, they are not able to forget about each other, even after many years without seeing each other.They were friends of this child when they explored Brooklyn in search of adventures.The years they spent in Brooklyn impacted their lives, as they were very attached to the place.That's because Brooklyn was diverse, full of colors and sounds which functioned as a living organism essential to their personality.

Over the years, they've seen Brooklyn change in many ways, but Brooklyn always organized itself, keeping its diversity intact.

More information about "Eraser Tattoo":

https://brainly.com/question/20287690

1. What two metaphorical "fires" does Scout have to choose between at the beginning of the chapter?

Answers

Answer:the fire at the beginning of the chapter

Explanation:

Other Questions
The computer monitor to the right has a length of 44 inches anda width of 38 inches. Find the length of the diagonal. Round youranswer to the nearest hundredth. The police___ that the children died in an accidenta. believes c. believeb. is to believe d. are believing Gravitational force acts on all object in proportion to their masses. Why then, a heavy object does not fall faster than a light object? Eleventh gradeX.1 Identify and correct errors with subject-verb agreement 08SYou have book covers to reveal! Co toFind the error with subject-verb agreement. Select the incorrect verb and type it correctiy.The metric system, first created by French scientists in the 1790s, isbased on a unit of length known as the meter. Approximately 3.28 feetare the equivalent of one meter,This is for English !!! Blair worked for 4 2/5 hours and earned $36.30. How much would she earn if she worked for 5 4/5 hours? Enter your answer in the box.PLEASE HELP ASAPPPPP!!! I WILL GIVE BRAINLIEST AND 50 POINTS!!! PLEASE HELP!You are camping and have only a 3 cup container and a 5 cup container. You need to measure 1 cup of water into a pot. How can you do this? Is there more than one way? Explain. How does Equiano's fear of being eaten by slavers serve as a metaphor for slavery itself ? 12 for every 2 male birds in a bird cage there are 5 females. What is the ratio of the males to females 2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night.