Which adaptation is common to animals that live in temperate grasslands?
structures to dig burrows
keen eyesight to help them see in the evening
a thick insulating layer of fat
large ears to regulate body temperature

Answers

Answer 1

Answer:

This is 100% right.

Explanation:

Which Adaptation Is Common To Animals That Live In Temperate Grasslands?structures To Dig Burrowskeen
Answer 2

Temperate grasslands are characterized by vast expanses of open grasslands with few trees and shrubs, so structures to dig burrows are a common adaptation for animals that live in temperate grasslands, as is preset in the first option.

What are temperate grasslands?

Temperate grasslands are biomes characterized by vast expanses of open grasslands with few trees or shrubs. These ecosystems experience a wide range of temperature fluctuations between seasons, with hot summers and cold winters. As a result, animals that live in temperate grasslands have evolved adaptations that enable them to survive in this challenging environment. One of the most common adaptations of grassland animals is the ability to dig burrows. Burrows provide shelter and protection from predators, as well as a stable microclimate for animals to live in.

Hence, structures to dig burrows are a common adaptation for animals that live in temperate grasslands, as is present in the first option.

Learn more about the temperate grasslands here.

https://brainly.com/question/31190071

#SPJ2


Related Questions

NEED ANSWER! WILL BRAINLIST!


•During the mining process, which step immediately follows separating the mineral from the waste rock?


A. refining

B. distribution

C. crushing and milling

D. drilling and blasting

Answers

Answer:

C

Explanation:

Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight

Answers

Bone —> provides structure for the body.

Heart —> pumps blood through the body.

Stomach —> breaks down food into small particles.

Lung —> oxygenates blood.

Which of these describes the complexity of abiotic and biotic factors within an ecosystem that supports a specific species?
A.fauna
B.biome
C.climate
D.habitat

Answers

In an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.

What is an Habitat?

An habitat can be described as the sum total of resources, abiotic and biotic factors that are found in a particular environmental area which support the survival and growth of a specific species that is better adapted to it.

Examples of HabitatsWoodland Forest SeashoreGrassland

Therefore, in an ecosystem, the term that describes the complexity of the abiotic and biotic factors which supports a specific species is: D. habitat.

Learn more about habitat on:

https://brainly.com/question/931161

What is Ecological Sustainability? What happens if we use all of our planet's resources without replacing them?

Answers

Answer:

Ecologically sustainable development is the environmental component of sustainable development. It can be achieved partially through the use of the precautionary principle. The precautionary principle (or precautionary approach) is a broad epistemological, philosophical and legal approach to innovations with potential for causing harm when extensive scientific knowledge on the matter is lacking. It emphasizes caution, pausing and review before leaping into new innovations that may prove disastrous

Explanation:

The triplet code of bases for RNA may be represented by all of the following except -
F CGT
G CGA
H CGG
O CGU

Answers

Cgt. DNA has the base pairs A,T,C,G, but RNA has A, U, C, G.

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

Pandas are classified as herbivores despite their taxonomic classification as a carnivore.

One important function of bones is to produce ……………….

Answers

Answer:

Red blooded cell, White blooded cell and platelets

Leukocyte, erythrocytes , platelets

All sugars are considered:

a carb

a fat

just sugars

a lipid

Answers

Answer: fat......................................

All sugars are considered as fat.

reproduction is not necessary for the continuation of species

Answers

Answer:

It is necessary.

Explanation:

If a member of a species doesn't reproduce, other members of the same species will become extinct.

I need help please ??!!!!!

Answers

Answer:

1: false

2: true

3: true

Explanation:

sorry if they wrong its on me if u use them tho

65 points, anwser asap, graph below

What is happening to the deer population between the years 2005 to 2010? Support with reasoning from our model of population growth.

Answers

Answer:wolves

Explanation:

wolves decreased the population because they kept increasing so people killed the and a couple of years later they went up the so they brought wolves back!

WILL GIVE BRAINLEST Why do plants store some of the food they produce?
A. to live through periods when they already have too much food
B.to have tough structures for defense
C.to provide food for other plants
D.to survive periods when they cannot make enough food

Answers

Answer:

D is your answer

Explanation:

there are times when plats cant photosynthesis to make food. So they rely on their food storage so they don't die.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

Pls, help with science (:

Answers

what can i help u ask me if i can i will say you

What is the most valid conclusion regarding ocean depth temperature, based on the data? The temperature and salinity increase with increasing depth. The salinity increases as the depth goes closer to zero. The bottom of the ocean is frozen and salinity levels are low. The ocean temperature never rises above 10°C and salinity remains constant.

Answers

The most valid conclusion concerning ocean depth temperature is B. The salinity increases as the depth go closer to zero.

 

Effect of Salinity on Water Depth

Decreasing ocean temperature increases ocean salinity. These occurrences put pressure on water as the water depth increases with decreasing temperature and increased salinity.

 

What is Ocean Salinity?

Ocean Salinity refers to the saltiness or amount of salt dissolved in a body of water. The salt dissolution comes from runoff from land rocks and openings in the seafloor, caused by the slightly acidic nature of rainwater.

 

Thus, the most valid conclusion one can draw regarding ocean depth temperature is Option B.

Learn more about ocean depth temperature and ocean salinity here: https://brainly.com/question/1512203 and https://brainly.com/question/10335431

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?

Answers

Answer:  Schizophrenia is considered a disorder of the mind, influencing the way a person thinks, feels and behaves.

Explanation: Physical health is also important because if it is compromised, many of the benefits of improved mental health will be offset. Compared with the general population, schizophrenia patients are at increased risk of weight gain, abdominal obesity, diabetes, metabolic syndrome, and cardiovascular disease.

Answer:

Schizophrenia involves a range of problems with thinking (cognition), behavior and emotions. Signs and symptoms may vary, but usually involve delusions, hallucinations or disorganized speech, and reflect an impaired ability to function. Symptoms may include: Delusions.Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems

Explanation:

Have a great day!

6. All of the following are renewable resources except for:
A. fossil fuels
B. soil
C. water
D. forests

Answers

a - fossil fuels

step by step explanation:

fossil fuels are non-renewable and will run out

A. Fossil fuels

It’s the only one that isn’t renewable

the empirical (scientific) method of study is based on ______

Answers

Answer:

Empirical research is based on observed and measured phenomena and derives knowledge from actual experience rather than from theory or belief.

Key characteristics of empirical research:

- Specific research questions to be answered

- Definition of the population, behavior, or phenomena being studied

- Description of the process used to study this population or phenomena, including selection criteria, controls, and testing instruments (such as surveys).

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

Steroids are a type of what?

lipids

carbs

sugar

hormone

Answers

Answer:

lipids

Explanation:

5. What does the pH scale measure and why is this important?

Answers

It measures the relative amount of hydrogen and hydroxyl ions in water. It’s important, because it’s an indicator that is changing chemicals of water.

what's photosynthesis are

Answers

Answer:

Production of sucrose in plants from light energy

Explanation:

PLEASE HELP ME ANSWER THIS!!!!!
Outline a heart-healthy “plan” for a person’s whole life: in other words, provide at least two pieces of advice appropriate for a person interested in heart health across their lifespan. Discuss advice appropriate for newborns or very small children; young adults between 18 and 24 years of age; someone in their 40s; and someone over 65. Provide at least one piece of age-appropriate advice specific to the interests, activities, and general health of an average person in each age group.

Answers

A heart-healthy plan for everyone is to eat lots of fruits and vegetables. It's also important to eat low-fat dairy products.

The heart is a vital organ in the body as it keeps the circulation of blood. For children, they should be served fruits and vegetables everyday. They should also eat whole grains.

For adults, they should eat more fish and less red meat. They should also eat lots of fruits and vegetables. Nuts, beans, legumes, and low-fat dairy products are also important for the heart.

Learn more about the heart on:

https://brainly.com/question/75085

The biome immediately south of the Taiga is the ______.
(A) Temperate deciduous forest,
(B) Savanna
(C) Tundra
(D) Chaparral.

Answers

Answer:

tundra

Explanation:

why are the offspring of coral identical to the parent

they reproduce sexually so offspring have increased genetic variation

they reproduce asexually so offspring have increased genetic variation

they reproduce sexually so offspring have decreased genetic variation

they reproduce asexually so offspring have decreased genetic variation

Answers

Answer:

they reproduce asexually so offspring have decreased genetic variation

Explanation:

when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!

In cocker spaniels, solid color (S) is dominant over spotted (s). If a solid male is crossed with a spotted female and they produce all solid colored puppies, the genotypes of the parents must be:

Answers

Answer: the genotypes must be solid that is. if the male is a solid colored genotype

How and why does the surface of the earth change
of the earth has changed?

Answers

Answer:

How and why does the surface of the earth change

of the earth has changed?

It can be hard to describe change on the surface without bringing up the interior. Earth is a system of constantly changing interactions between interior, surface conditions, and external events.

Volcanoes bring up new material and even create land. The Hawaiian islands, for instance are a chain of volcanoes on the surface, but the underlying structure is a single magma plume. In a way, the entire chain of islands is a single volcano that breaks through different places as the crust moves over it.

On that note: plates. Earth is made of tectonic plates that constantly move. Some grind against one another, others collide, and some pull apart. Depending on direction and interaction, you get anything from mountains, to spreading valleys, oceans, and anything else you care to name. Mountains can almost be viewed as something akin to the ridges of build up ice on a window scraper.

Erosion by water, wind, sand, chemicals, and living things changes the surface too. Materials on the surface face an incredible number of forces breaking them down and dragging them away, even as those same forces in different places and situations deposit those materials in other places, building things back up.

“Stardust” is also a thing. Rocks, dust, debris, and all sorts of random, natural cra.,p is constantly hitting our atmosphere. Regardless of whether or not it stays mostly intact, some material breaks off, and most of it does tend to make it to the surface, adding tiny amounts of matter all the time. …of course something BIG enough hitting the surface can throw rocks and chunks of surface clear into space, so that’s a thing too.

Remember when I mentioned living things? Living things D.,IE! Gac.k! And when they do, they break down into organic gunk. Soil - the stuff we grow crops in - is basically minerals and dead things that are decaying into nutritious, yummy, dir.,t.

Weather changes things too. Rain erodes, but rain that soaks a rock, and then is frozen by low temperatures, breaks the rock. Too much rain can create flooding, which results in a lot of sediment moving downstream. Heat can dry things out, crack the ground, and even slowly cook one kind of soil into another. Lightning can make glass out of sand, snow can collapse weak ground, not enough rain can dry out ground that could si.nk down without the extra pressure, and too much rain can literally move mountainsides if enough water adds its weight to the rocks and dir.t.

It’s always changing, and there is always more complexity to go into when studying it. There’s seldom a single cause, or reason, or effect for anything.

Explanation:

Have a great day!

The surface of the earth is constantly changing.

Explanation:

Wind, water,and ice break down large rocks and move sediments on the surface. Some events, though, change earth's surface much more quickly. These include volcanic eruptions, earthquakes, and landslides.

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Answers

A :) lllllllu fluctuating

4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next

Answers

Answer:

condensation, precipitation, infiltration, runoff, and evapotranspiration.

condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.

what is condensation ?

It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.

It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.

The boiling point and the condensation point are same and take place at 100 degrees Celsius.

The temperature range of condensation occurs between 0 degree Celsius to  100  degree Celsius.

In water cycle due to condensation  water molecule  forms a cumulous clouds and fog followed by fall down of water droplets on the  Earth’s surface as precipitation, which is commonly called rain.

Rain water enters the earth’s waterways, soil absorbed by plants or   freeze into its solid form ice form.

Learn more about water cycle, here:

https://brainly.com/question/9243222

#SPJ5

Other Questions
find x .....merry Christmas :))) what global winds form much of the weather in the us? What do local governments do? Yellow hair (Y) can be crossed with red hair (R) to create strawberry-blond. A yellow haired person is crossed with a strawberry-blonde person. What is the genotypic & phenotypic ratio of the children? write 10 place where computer use and it uses Phan fills the tank of her car with gasoline before starting her road trip. The table below shows the amount of gas left in her tank as she drives. Number of Hours vs. Amount Left in Tank Number of Hours Spent Driving (h) 3 5 7 9 Amount of Gas Left in Tank, in gallons (g) 12 8 4 0 Which equation models the amount of gas left in the car as Phan drives, and how many gallons of gasoline does it take to fill her tank? g = 18 " 2h; 18 gallons g = 18 " 2h; 16 gallons g = 3h 3; 30 gallons g = 3h 3; 12 gallons. The diagram shows the floor of a living room. What area of carpet will be needed to cover the floor? Remember to include your units of measure. Measure the paper clip to the nearest 1/8 inch. A. 1 2/8 inchesB. 1 1/2 inchesC. 1 4/8 inchesD. 1 3/8 inches Which statement best explains why these siblings are genetically different from each other? In which direction must the graph of Rx) = 7% be shifted to produce the graph of g(x) = 7% + 7?O A rightOB. UpOC. leftOD. down help please cant figure out the answer A football team had 55 players at the start of the season What is mAngleMHJ? 35 50 72.5 92.5 Elton has 2 jobs and can work at most 32 total hours per week. He makes $9.00 per hour as a dog walker and $10.00 per hour as a store clerk. He wants to earn a minimum of $200 per week. Which is system of inequalities can be solved to find the possible combination of hours worked at each job that will help him to reach his goal? juliana wrote the terms below. 8, 4, 0, 4, 8, 12 what do these terms represent? an arithmetic series an arithmetic sequence a geometric series a geometric sequence How do you balance a firms need to succeed and the need for not asking the workers for perfection? I WILL GIVE 30 POINTS TO THOSE WHO FILL IN THE BLANK CORRECTLY A contractor decides that he can build a house in eight weeks using 5 men. If he employs 3 more men, how long will the job take? Assume that all the men work at the same rate. write types of cellular respiration and their function? what is the answer 4.3 x .8