What is what is the biggest change in leg anatomy from the dawn horse to modern horse

Answers

Answer 1

Answer:

The modern horse, in addition to having much longer legs, has developed hooves in place of hand/foot bones.

Explanation:

Just read the text :)


Related Questions

What is the mRNA that would be transcribed from this strand of DNA?

Answers

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Label what each letter means (photosynthesis)

Answers

Answer:

A- sunlight B-Oxygen C-carbon dioxide emission

Explanation:

which diseases are caused by fungi?
A. Botulism and Malaria
B. Athlete's foot and botulism
C. ringworm and athlete's foot
D. Malaria and ringworm​

Answers

Answer:

Ringworm and athletes foot

Explanation:

The answer is C, ringworm and athletes foot are fungal diseases

hope this helps :) give brainliest?

C.Ringworm and athletes foot

Some fungal diseases are some skin disease , ringworm , athletes foot

Make a claim for reasons
a
not to build homes and roads on a wetland.

Answers

Answer:

floods

Explanation:

if your in the wetlands then it probably floods pretty bad so you don't want to build there

Which of these was a fundamental cause of ww1

Answers

Answer:

C) the growth of nationalism in Europe

Explanation:

took test

pls mark brianilest

<3

25 POINTS
Check all the continents below that experienced an increase in average annual temperature.

Europe

Africa

North America

South America

Antartica

Australia

Asia

Answers

Answer:

Europe, North America and Asian:

The forebrain is where the highest and most complex intellectual functions, such as thinking, take place. True or False?

Question 4 options:
True
False

Answers

Answer:

True

Explanation:

the cerebrum controls these activities and is a part of telencephlon,forebrain

Using the 10% rule when studying trophic pyramids, if the autotrophs produce 100 joules of energy, how much energy is passed on to the herbivores?

A: 15 Jouls
B: 10 Jouls
C: 0.1 Jouls

Answers

The answer is
B- 10 jouls

- Explain the differences in growth between animals and plants

Answers

Answer:

The differences are given below

Explanation:

Plants differ from animals in their manner of growth. As young animals mature, all parts of their bodies grow until they reach a genetically determined size for each species. Plant growth, on the other hand, continues throughout the life span of the plant and is restricted to certain meristematic tissue regions only.

A student is designing a device for humans to communicate through detectable light. Which waves should the student use from the electromagnetic spectrum? A X-ray waves B visible waves C infrared waves D ultraviolet waves

Answers

A.it should be a x-ray waves

An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.

Answers

Answer:

B

Explanation:

there are complex feeding mechanisms at work to protect the other species in the food web

The____focuses the light


lens

pupil

retina​

Answers

I think it Pupil? Because the light helps us see color by the reflection of the sun?

(11)
19) As water is heated by the sun, it becomes less
dense and rises. What causes the decrease in the
density of warming water?
A. The water particles move faster, causing the
water to expand.
B. The water particles move slower, causing the
water to expand.
C. The water particles move faster, causing the
water to contract.
D. The water particles move slower, causing the
water to contract,
bluod
w

Answers

I think the answer is either A or C

WILL MARK THE BRAINLIEST!!!

Name the three major Subphyla and an example of an animal in each

Answers

Answer:

The three major Subphyla are:

Explanation:

Vertebrata (fish, amphibians, reptiles, birds, and mammals)

Tunicata or Urochordata (sea squirts, salps)

Cephalochordata (which includes lancelets). There are also extinct taxa such as the Vetulicolia.

hope this helped :)

6-10 Importance of planting​

Answers

Answer:

Importance of Planting

Explanation:

Trees increase property values.

Trees clean the air.

Trees slow water runoff.

Trees prevent soil erosion.

Trees help buffer noise pollution.

Trees cool our homes, streets, and cities.

Trees can save you money on energy costs.

Trees are beautiful.

Define what it means when we say a molecule is Hydrophobic

Answers

Answer:

Hydrophobic is a property of a substance that repels water. It means lacking affinity for water, and tending to repel or not to absorb water. Hydrophobic molecules tend to be non-polar molecules and group together.

Explanation:

Hydrophobic molecules tend to be non-polar molecules and group together, thus, prefer other neutral molecules and nonpolar solvents. Oils and fats are hydrophobic.

Which one of the following is the softest?

(A) Aluminium

(B) Iron

(C) Lithium

(D) Sodium

Answers

Answer:

Sodium

Explanation:

Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .

Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?​

Answers

Higher pleasure is a pleasure that would be chose by a greater number in the population.

What is higher pleasure?

The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.

I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.

What is higher pleasure: https://brainly.com/question/22406307

8. In
In the
rock Cyce, igneous, sedimentary
and metamorphic
become magma again.
How does this happen?



Earth science

Answers

Answer:

Over millenia, these rocks get pushed back into the Earth's mantle, and get pushed into a volcano heating it up and turning it into magma.

Explanation:

Magma is molten rock, meaning existing rocks must be getting melted, the way the melting happens is by the rocks getting pushed into the ground by landforms and penetrating the mantle, this is how the cycle starts all over again.

If a cell has 26 chromosomes before meiosis begins, how many tetrads will it contain after Anaphase I?


Answers

If a cell has 26 chromosomes before meiosis begins, there will be 13 tetrads after Prophase I.

https://study.com/academy/answer/if-a-cell-has-26-chromosomes-before-meiosis-begins-how-many-tetras-will-it-contain-after-prophase-1-and-anaphase-1.html

Answer:

After Anaphase I, the cell will contain 13 tetrads, since each of the 26 chromosomes has been divided into two parts, representing a total of 26/2 = 13 tetrads.

Which international organization had the goal of ending smallpox?
A.World Health Organization
B. Organization of American States
C.World Trade Organization
D. North Atlantic Treaty Organization
E.US Olympic Committee

Answers

Answer: World Health Organization.

Explanation:

The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by
the action of
(A) decomposers
(B) producers
(C) primary consumers
(D) secondary consumers

Answers

Answer:

A

Explanation: Just what decomposers do, break down organic and sometimes inorganic material

The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by the action of decomposers. Thus, the correct option is A.

What is the Environment?

The Environment may be characterized as anything which is present in the surrounding of any living organism. The term "Environment" was given by Carlyle.

Decomposers are organisms that can significantly have the capability to break down dead, decaying organisms that remarkably contain organic as well as inorganic material in their body composition.

Such types of organisms convert dead and decaying matter into humus. They are also known as detrivores.

Producers are those that can synthesize their own food with the help of sunlight through the process of photosynthesis. While primary consumers are those that directly deed on the producers. They are also known as herbivores.

Therefore, decomposers are living organisms that perform the action of converting all organic and inorganic materials of the living organisms into the environment.

To learn more about Decomposers, refer to the link:

https://brainly.com/question/380333

#SPJ6

Which of the following is the strongest conclusion to an informative essay about Sherlock Holmes's strongest character traits as a detective?

A. In conclusion, Sherlock Holmes's drive to find answers and his observation skills led to his success as a detective. Plenty of readers admired this detective and went on to become detectives, too. While none were as famous as Holmes, many joined him in saying, "It's elementary, Watson!"

B. In summary, Sherlock Holmes was determined to find answers, no matter what.
He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

C. To conclude, Sherlock Holmes became a detective so that he could use his character traits for good. He searched for answers in The Mystery of the Lost Gem, even when Mrs. Blakely doubted him. Sherlock's drive to find answers was rewarded at last.

D. To summarize, Sherlock Holmes's character traits led to his success as a detective. Many readers admired this detective and tried to imitate him, even going so far as to say, "It's elementary, Watson!"

Answers

The strongest conclusion to this informative essay about Sherlock Holmes is: B. In summary, Sherlock Holmes was determined to find answers, no matter what. He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

What is an informative essay?

An informative essay can be defined as a literary work that presents factual information about an event, people, places or things.

This ultimately implies that, the main purpose of an informative essay is to provide sufficient information and explanation about an event, object, person (individual), places, or phenomenon to the readers (audience).

In this context, Sherlock Holmes's strongest character traits such as his five senses, as a detective should be highlighted or presented to the readers (audience).

Read more on informative essay here: https://brainly.com/question/19949636

S-waves can move through both solid and liquid substrate.
A. True
B. False

Answers

Answer:

B. False

Explanation:

Why can't S-waves move through both solid and liquid substrate? The reason why is that only solids can be traversed by S-waves. This is due to the fact that liquids and gases do not resist altering shape.

Compare how energy is used worldwide with how it is used in the United States.

Answers

Answer:

the U.S comsumes almost 15% of the worlds energy

Explanation:

yes

Is Turritopsis dohrnii capable of bioluminescence?
A. Yes Turritopsis dohrnii is capable of bioluminescence.
B. No Turritopsis dohrnii is not capable of bioluminescence.

Answers

Answer:

A. Yes Turritopsis dohrnii is capable of bioluminescence.

Explanation:

Which statement best describes the relationship between cellular respiration and photosynthesis?

a.Cellular respiration and photosynthesis have the same products but use different reactants.

b.Cellular respiration and photosynthesis are the same processes; one occurs in animal cells and the other in plant cells.

c.Cellular respiration produces oxygen, which is the reactant required for photosynthesis.

d.Cellular respiration produces carbon dioxide, which is the reactant required for photosynthesis.

Answers

i’m thinking it would be c

I need this question answered thanks

Answers

Answer:

vacuole

Explanation:

nothing to do with the same to you

The Answer is Vacuole. How. It just Is.

If allowed to grow naturally, minerals will form:

conglomerates
layers
rocks
crystals​

Answers

Answer:

D.) crystals

Explanation:

have a good day :)

Answer:

crystals​

Reason :

Crystals occur in nature when particles cluster to solidify as a liquid cools down and solidify. This is referred to as crystallization, and it can occur when molten solidifies or when liquid evaporates from an organic combination.

Please help I don’t know the answer

Answers

Answer:

c.

Explanation:

Other Questions
find the area of the triangle when the height is 3 1/4 and the base is 4 4/5 how many lines of symmetry does this shape have ??? MARKING BRAINLEISTT What is an argumentativestatement? in your own words pls!!! Solve for x.4x24=x6Enter your answers in the boxes. ____ involves a break with past experiences and the learning of new values and norms. a. institutionalization c. both a and b b. resocialization d. neither a nor b is it ok to go to school even tho im coughing for almost a week now What is 360 divided by 9 A business owner opens one store in town A. The equation p(x) = 10,000(1.075)' represents the anticipated profit aft-t years. The business owner opens a store in town B six months later and predicts the profit from that store to increasat the same rate. Assume that the initial profit from the store in town B is the same as the initial profit from the store irtown A. At any time after both stores have opened, how does the profit from the store in town B compare with the profrom the store in town A?aO 65%O 96%104%154%Mark this and retium Ill give 20 points and youll be marked as brainliest. Need it ASAP! (07. 01)How many solutions can be found for the equation 4x = 4x? Zero One Two Infinitely many. A ball has a diameter of 6 inches. A smaller ball has a radius of 2 inches. What is the approximate difference between the volume of the two balls please help and explainn!!!! The judicial branch governedthe provinces of Rome.TrueFalse In the diagram, RST XYZ. Find the scale factor from RST to XYZ. What is the concentration of Ni2+(aq) ion in a 0.035 M Ni(NO3)2 solution that is also 1.00 M NH3? (Kf for Ni(NH3)6 ^2+ = 5.5 108) a) 3.5 102 M b) 6.4 1011 M c) None of these is correct. d) 2.6 1010 M e) 7.9 1011 M The term Manifest Destiny was coined in 1845. How long before that had the ideas actually existed? Please help me please please please help Which of the following movesmolecules against theconcentration gradient?A. Active transportB. DiffusionC. Endocytosis Solve for x. Round to the nearest hundredth.1718 Xwhat trigonometric function would you use to find x?O CosineSineTangentO SecantO Cosecant Is work done in this example: A student lifting a heavy backpack off of the floor.