Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Which plate forms a boundary with the African Plate?
Answer:
the plate which forms a boundary of the African plate is Antarctic Eurasian and South American
Explanation:
Which plate forms a boundary with the African Plate?
A. Pacific
B. South American ✓
C. Nazca
D. Philippine
Northern part ↝Eurasian PlateWestern part ↝ North & South American PlateSouthern part ↝ Antarctic Plate Eastern Part ↝ Arabian plate✦According to a theory , tectonic plates are the result of splitting of a more larger landmass of earth back in the ages
✦ There are 7 major tectonic plates
Which of the following DO NOT describe the earth’s characteristics? *
A. Earth has an ozone layer that protect the planet from the harmful ray of the sun.
B. Oxygen contains 78% of the earth’s atmospheric gas.
C. The earth’s magnetic field serves to deflect most of the solar winds.
D. The location of the earth is far from various kind of hazards.
Answer:
B
Explanation:
The atmospheric gas contains 78% Nitrogen and 21% Oxygen. It contains more of Nitrogen than Oxygen.
Oxygen is a reactive gas so its precentage shouldn't be much. Hence, Nitrogen serve as a diluent to reduce the corrosive activity of Oxygen
Answer:
B
Explanation:
The air in Earth's atmosphere is made up of approximately 78%
nitrogen and only 21% oxygen.
In general, how will parts of an ecosystem that are destroyed by natural events or by human development change over time?
Answer:
They will adapt.
Explanation:
I really like your anime profile.
what is cell biology ?
Answer:
Cell biology is a branch of biology that studies the structure, function and behavior of cells. All living organisms are made of cells. A cell is the basic unit of life that is responsible for the living and functioning of organisms. Cell biology is the study of structural and functional units of cells.
Answer:
As a branch of biology, cell biology studies the structure, function, and behavior of cells. A cell is the basic unit of life that is responsible for the living and functioning of an organism. Cell biology is the study of structural and functional aspects of cells.
What is the name of the structure that the microtubules blind to on the chromosome
Answer:
The microtubules bind to the kinetochore, a protein complex located on the chromosome. The kinetochore is located specifically on the centromere, the site where the two sister chromatids are connected.
Which discovery did Gregor Mendel make?
Answer:
how the gene transfer with the help of pea plant
What are the Component and functions of phospholipids
Answer:
Phospholipids are compound lipids, consisting of phosphoric acids, nitrogen base, alcohol and fatty acids. These compound lipids are major components of the cell membrane and also provide a fluid character to the membranes.
Cell Biology: Polysaccharide Examples
Manure Meaning: Leaf Structure
•What are the Component and functions of phospholipids?
Answer:
•Phospholipids are molecules with hydrophilic phosphate heads and hydrophobic lipid tails. They comprise cellular membranes, regulate certain cellular processes, and possess both stabilizing and dynamic qualities that can aid in drug delivery.
Explanation:
#Let's Study
#I Hope It's Help
#Keep On Learning
#Carry On Learning
What might happen if DNA replication was not semi-conservative?
Answer:
MB WRONG answer
Explanation:
Chemical fossil fuel is most often released by what process?
Answer:
D
Explanation:
Please help me please
Answer:
Question 12 and 13
Explanation:
12) True
13) Habitat destruction, degradation (Loss damage)
PLEASE HELP
The environment can affect how
organisms look and how their genes
function.
True
False
Answer:
True
Explanation:
organisms adapt to their environment if it's necessary for survival
WILL GIVE THE BRAINLIEST!!!
List three places chemoreceptors may be located in arthropods.
PLEASE HURRY !!!
A student examines a picture of an important biological molecule in a textbook and writes four statements about the molecule in a chart.
Which statement needs to be revised to make it true?
Answer:
4 the molecule contains genes
Explanation:
the answer is statement 4
The temperature range in a pond in which all three-fish species could grow and survive is most likely
a.2°C to 8°C
b. 22°C to 28°C
c. 12°C to 18°C
d. 32°C to 38°C
Answer:
b is the answer I think
Explanation:
if it's not correct please tell me
The temperature range in a pond in which all three-fish species could grow and survive is most likely
a.2°C to 8°C
b. 22°C to 28°C
c. 12°C to 18°C ✓
d. 32°C to 38°C
Average temperature for aquariums ⇢25°CI don’t know what this is for
Overflow during a heavy rainstorm from a wastewater treatment plant could
A) weaken housing foundations
B) create over-treated drinking water
C)send polluted runoff into nearby ponds
HURRY I NEED HELP ASAP
What is the mRNA that would be transcribed from this strand of DNA?
Every time you sample the population
during a population sampling study, you
need to
A. collect individuals randomly
B. collect only the females
C. collect the largest individuals first
D. collect only the healthiest-looking individuals
Answer:
collect randomly
Explanation:
all others are a biased sample there fore inaccurate
Which effect on biodiversity could start out small and grow over time to affect the larger ecosystem level? (1 point)
O large oil spill in a coastal habitat
O introduction of an invasive
species
O unexpected drought during the rainy season
O human family logging a patch of land to build a cabin and fuel their fireplace
Answer:
D. is your answer
Explanation:
this is because when you cut logs they release carbon back into the air and that can be bad over time.
A human family enters a piece of land to build a cabin and their fireplace effect on biodiversity can start small and grow over time to affect large ecosystem levels. So, the correct option is D.
What is Biodiversity?Biodiversity or biological diversity is defined as the diversity and variability of life on Earth as a measure of variation at the genetic, species and ecosystem levels. Biodiversity is explained as the diversity of all living things that are different plants, animals and microorganisms, the genetic information which they contain and the ecosystems they form.
Biodiversity is explored at three levels – genetic diversity, species diversity and ecosystem diversity. A human family enters a piece of land to build a cabin and their fireplace effect on biodiversity can start small and grow over time to affect large ecosystem levels.
So, the correct option is D.
Learn more about Biodiversity, here:
https://brainly.com/question/23101752
#SPJ2
I need help as soon as possible about the designing a device to protect an egg on impact assignment on engenuity! I have to idea where to even start with designing a device! please help!
Question 7(Multiple Choice Worth 4 points)
(04.03 LC)
Which process takes place in both plant and animal cells?
Conversion of solar energy
Cellular respiration
O Formation of glucose
O Photosynthesis’s
Answer:
Cellular respiration
Explanation:
Conversion of solar energy and photosynthesis require specialized equipment that animal cells just don't have. Because animal cells don't have chloroplasts, those two options are out of the question.
Animals also do not create glucose. They break down glucose and O2 into energy, H2O and CO2. Plants, on the other hand, use energy, H2O, and CO2 to create glucose and O2.
Cellular respiration is the process by which cells break down "food" into useable energy. As you can see, this happens in both plant and animal cells!
how mutation cause colorectal cancer
Answer:
A very small portion of colorectal cancers are caused by inherited gene mutations. Many of these DNA changes and their effects on the growth of cells are now known. For example: Familial adenomatous polyposis (FAP), attenuated FAP (AFAP), and Gardner syndrome are caused by inherited changes in the APC gene.When light is reflected, it ______________.
Question 2 options:
curves around the substance
bounces off the substance
passes through the substance
is converted to another form of energy
Answer:
bounces off the substance
Explanation:
As in mitos/s, in meiosis the chromosomes all line up at the equator of a cell
in
A. telophase
B. metaphase
C. prophase
D. anaphase
Answer:
B. Metaphase
Explanation:
Metaphase: Chromosomes and their copies line up in the middle of the cell.
What covers the skeleton
QUESTION-
What covers the skeletonANSWER-
periosteumExplanation:
The tough, thin outer membrane covering the bones is called the periosteum. Beneath the hard outer shell of the periosteum are tunnels and canals through which blood and lymphatic vessels run to carry nourishment for the bone. Muscles, ligaments, and tendons may attach to the periosteum.[tex] \rm\color{wheat}by - \: denfor[/tex]
hope it helps
The following diagram shows a DNA template which is 70bp long (spaces indicate 10bp blocks) and the sequence of 4 primers. What size products (if any) would be generated from a PCR with the following primer combinations? Briefly explain your answer.
5’ AAGCCTTGCA TTGACTCGGA GCGCGTATTA GCGTAAGCCT CAGAGTCCGA TTCCAGTCAG CTAGCGCATT 3’
3’ TTCGGAACGT AACTGAGCCT CGCGCATAAT CGCATTCGGA GTCTCAGGCT AAGGTCAGTC GATCGCGTAA 5’
Primer 1 5’CCTTGCATTG3’
Primer 2 5’ GGAACGTAAC 3’
Primer 3 5’ CCGATTCCAG 3’
Primer 4 5’ TGCGCTAGCT 3’
a. primers 1 and 2
b. primers 1 and 3
c. primers 1 and 4
d. primers 2 and 3
e. primers 2 and 4
f. primers 3 and 4
NONE of these DNA fragments can be completely amplified by using these primer combinations. PCR is a molecular biology technique.
What is PCR?Polymerase chain reaction (PCR) is a technique used in molecular biology to replicate (amplify) a given fragment of DNA.
In this technique (PCR) primers sequences must be used to add nucleotides to the amplified DNA strands during DNA replication.
These nucleotide primers must be sequence complementary to the fragment of DNA desired to be amplified by PCR.
In this case, none of the DNA fragments can be fully generated by using these primers or any of their combinations.
Learn more about PCR here:
https://brainly.com/question/7177771
Which of the following is true about the efficiency of energy transfer in an ecosystem?
a. The more energy the organism requires, the more efficient the energy transfer.
b. All energy transfers have the same efficiencies.
The less energy the organism requires, the more efficient the energy transfer.
d. The most efficient energy transfers are in large, warm-blooded animals.
C.
Please select the best answer from the choices provided
Ο Α
ОВ
O O O O
OD
Answer:
a because ecosystem can transfer into an energy by oragnism ,it is also can transfer the ecosystem by following
What is a guillemot?
Where does she lay her eggs?
Why are her eggs sharply tapered?
Answer: All answers below
What is a guillemot: An auk (seabird) with a narrow pointed bill, typically nesting on cliff ledges.
Where does she lay her eggs: Rock ledges
Why are her eggs sharply tapered: To stop them falling from their cliff-ledge nests.
Explanation:
Yw
~Tony
can someone help me
You need to show us the previous questions and reading material, or we won't understand the question...
Of the following disturbances, which can only be categorized as extreme (i.e., could not be considered small or medium
in scale)? (1 point)
O hurricane flooding in several cities in Texas
O wildfire across several counties in California
O volcanic eruption in the middle of the ocean
O rapid glacial retreat due to climate change
Rapid glacial retreat due to climate change.
The disturbances, which can only be categorized as extreme, are the rapid glacial retreat due to climate change.
What is the glacial retreat?The glacial retreat is when the terminal does not extend as far.
When the ice melts quicker than the snow falls, the retreat of glacial occurs.
When the glacier loses its ice more it gains, than water level rises.
Sometimes, the pieces of ice rocks float in between the water.
Thus, the correct option is D.
Learn more about the glacial retreat
https://brainly.com/question/1621563