What is the answer to this question in SSS, SAS, AA, or none

What Is The Answer To This Question In SSS, SAS, AA, Or None

Answers

Answer 1

Answer:

Step-by-step explanation:

40/32 ?=? (40 + 12.5) / (32 + 10)

  1.25  ?=? 52.5 / 42

   1.25   =  1.25

similar via SAS


Related Questions

Helpppp pleaseeee ????

Answers

Answer:

LQ = 54

Median = 69

UQ = 94

Step-by-step explanation:

This list is already sorted for you, so you don't need to worry about that, otherwise you would need to sort the numbers in ascending order. To find the median, we do [tex]\frac{n+1}{2}[/tex], where n is the amount of numbers. This gives us 4, so the median is at position 4, so the median is 69. The lower quartile is simply [tex]\frac{n+1}{4}[/tex], so 2, so the lower quartile is 54. The upper quartile is [tex]\frac{n+1}{2} X 3[/tex], so 6, so the upper quartile is 94.

What is the equation of the line passing through the point (2, 3) and perpendicular to the line y=2x+7?

Answers

Answer:

[tex] -\frac{1}{2}x + 4[/tex]

A rectangular garden is 24 feet wide. Its length is 5 feet more than twice the width. What is the area of the garden?

Answers

Answer:

1272 feet²

Step-by-step explanation:

Breadth (Width) =  24 feet

Length = (24 × 2) + 5

            = 48 + 5

            = 53 feet

Area = Length × Breadth

Area = 53 × 24

        = 1272 feet²

10. In a recent season, the San Francisco Giants
won 75 out of 162 games. What percent of their
games did they win? Round to the nearest tenth if
necessary.

Answers

Using the percentage concept, it is found that the San Francisco Giants won 46.3% of their games.

What is a percentage?

The percentage of an amount a over a total amount b is given by a multiplied by 100% and divided by b, that is:

[tex]P = \frac{a}{b} \times 100\%[/tex]

In this problem:

The Giants played a total of 162 games, hence b = 162.They won 75 games, hence a = 75.

Then:

[tex]P = \frac{75}{162} \times 100\% = 46.3\%[/tex]

The San Francisco Giants won 46.3% of their games.

You can learn more about the percentage concept at https://brainly.com/question/10491646

QUESTION 22 PLEASE HELP ME!!!!

Answers

Answer:

the answer is infinite

Step-by-step explanation:

would u like me to explain?

this drawing shows an isosceles triangle work out the size of angle a plz help as soon as possible thks




Answers

Answer:

70°

Step-by-step explanation:

Size of angle a = (180°-40°) ÷ 2 (angle sum of triangle; base angles of isos triangle)

                         = 140° ÷ 2

                         = 70°

Answer:

a + 40° = 180°

a t40°-40° =180°- 40°

a = 140°

Step-by-step explanation:

isosceles add up to 180°

Find the allowable height for the hypotenuse if the hypotenuse catheters are 4 cm and 9 cm

Answers

Answer:

L = 9.85 cm

Step-by-step explanation:

I guess you meant length for the hypotenuse. We just apply the pythagorean theorem:

L = [tex]\sqrt{(4 cm)^2 + (9 cm)^2} = \sqrt{16 cm^2 + 81 cm^2} = \sqrt{97 cm^2} = (circa) 9.85 cm[/tex]

Answer:

solutions given;

base:9 cm

perpendicular: 4 cm

hypotenuse:?

By using pythagorus law

hypotenuse^2: perpendicular^2+base^2

hypotenuse:[tex]\sqrt {4^2+9^2}[/tex]

hypotenuse:9.84cm

If a triangle has a base of 6' and a height of 4' its third side would be what?

Answers

Answer:

≈7.2

Step-by-step explanation:

hope this helps

Answer: ≈7.2

Explanation: a^2+b^2=c^2
6^2+4^2=c^2
36+16=c^2
52=c^2
c= 7.211102550927979…
c≈7.2

Find the number that makes the ratio equivalent to 9:1

Answer has to end with :8

Answers

the answer is 72 : 8

If the mean of five values is 8.2 and four of the valuesare 6, 10, 7, and12, find the fifth value.​

Answers

Answer:

6

Step-by-step explanation:

→ Do the 8.2 × 5

41

→ Minus the answer from the sum of the values

41 - ( 6 + 10 + 7 + 12 ) = 6

Simplify 4 to the seventh power over 5 squared all raised to the third power . (4 points)

a
4 to the tenth power over 5 to the fifth power

b
4 to the fourth power over 5

c
4 to the twenty-first power over 5 to the sixth power

d
12 to the seventh power over 15 squared

Answers

The answer is C, 4 to the 21st over 5 to the 6th power.

LAST ATTEMPT MARKING AS BRAINLIEST!! (Graph the image of the figure using the dilation given)

Answers

Answer:

[tex]V(1,2) \to V \ ' \ (0.5,1)\\\\U(0,2) \to U \ ' \ (0,1)\\\\T(-1,0) \to T \ ' \ (-0.5, 0)\\\\W(1,-2) \to W \ ' \ (0.5,-1)\\\\[/tex]

===========================================================

Explanation:

Multiply each coordinate by 0.5, which is the same as the fraction 1/2.

This causes the preimage to shrink to a smaller image.

The rule I'm using is [tex](x,y) \to (kx,ky)[/tex] where the scale factor is k = 0.5

Solve the system of equations using the substitution method.
S 4x + 5y=7
ly=3x +9
Enter your answers in the boxes.
2
X=
y=

Answers

Answer:

x = -2.

y = 3.

Step-by-step explanation:

If y = 3x + 9

Substitute this value for y in the first equation.

4x + 5(3x + 9) = 7

4x + 15x + 45 = 7

19x = 7 - 45

19x = -38

x = -38/19

x = -2.

with this value of x, substitute -2 in the second equation

y = 3(-2) + 9

y = -6+9

y = 3.

check if your values are all correct

4(-2) + 5(3) = 7

-8 + 15 = 15 - 8 = 7

Correct!

basically how to write y-3=4(x+2) in slope intercept form

Answers

Answer: y = 4x + 11

Step-by-step explanation:

The slope-intercept form is y = mx + b, where m is the slope and b is the y-intercept.

y = mx + b

Rewrite in slope-intercept form.

Simplify the right side.

Simplify 4(x + 2).

y - 3 = 4x + 8

Move all terms not containing y to the right side of the equation.

Add 3 to both sides of the equation.

y = 4x + 8 + 3

Add 8 and 3.

y = 4x + 11

Your Welcome! :)

The sum of two consecutive integers is -11. Find the number

Answers

Answer:

-5 and -6

Step-by-step explanation:

Lets do the equation: x+x+1=-11

Add: 2x+1=-11

Subtract: 2x=-12

Divide: x=-6

The smaller integer is -6

The larger integer is -5

Which of the following is a geometric sequence with a common ratio of 2?

A) 14, 28, 56, 112, ...
B) 64, 32, 16, 8, ...
C) 87, 85, 83, 81, ...
D) 14, 16, 18, 20, ...

Answers

Answer:

A

Step-by-step explanation:

Geometric sequences involve multiplication and the ratio of 2 means each number is multiplied by 2 to get the next number.

Please look for the question in the picture.

Answers

Answer:

C and B

Step-by-step explanation:

20%=1/5 so D+1/5D

1.2 = 120%

negative eight i multiplied by five i

Answers

40 is the answer uhhhhhhhhh yea I’m sure it’s

3.-Las 80 habitaciones de un motel se podrían alquilar todas las noches si el director cobrará
40 € o menos por habitación. Si se cobra (40+x) € por habitación, entonces 2x habitaciones
permanecerán vacantes. Si cada habitación alquilada le cuesta al director 10 € al día y cada
habitación no alquilada 2 € al día, ¿qué precio debería cobrar el director por habitación para
maximizar su beneficio diario?
4.- Un fabricante de automóviles vende 2000 coches al mes, con un beneficio medio de 1000 €
por coche. Las prospectivas de mercado indican que por cada 50 € de descuento que el
fabricante ofrezca a los compradores podría vender 200 coches más al mes.
¿Cuánto descuento debería ofrecer para maximizar el beneficio mensual?

Answers

3) Para maximizar su beneficio diario el director debería cobrar cada habitación a €56.

4) El fabricante debería ofrecer un descuento de 150€ para maximizar su beneficio mensual.

3- Dado que las 80 habitaciones de un motel se podrían alquilar todas las noches si el director cobrara 40€ o menos por habitación, y si se cobra (40+x) € por habitación, entonces 2x habitaciones permanecerán vacantes, para determinar, si cada habitación alquilada le cuesta al director 10 € al día y cada habitación no alquilada 2 € al día, qué precio debería cobrar el director por habitación para maximizar su beneficio diario, se deben realizar los siguientes cálculos:

80 x 40 - 80 x 2 = 304070 x 50 - 10 x 10 - 70 x 2 = 326060 x 60 - 20 x 10 - 60 x 2 = 328065 x 55 - 15 x 10 - 65 x 2 = 329566 x 54 - 14 x 10 - 66 x 2 = 329264 x 56 - 16 x 10 - 64 x 2 = 329663 x 57 - 17 x 10 - 63 x 2 = 3295

Por lo tanto, para maximizar su beneficio diario el director debería cobrar cada habitación a €56.

3) Dado que un fabricante de automóviles vende 2000 coches al mes, con un beneficio medio de 1000 € por coche, y las prospectivas de mercado indican que por cada 50 € de descuento que el fabricante ofrezca a los compradores podría vender 200 coches más al mes, para determinar cuánto descuento debería ofrecer para maximizar el beneficio mensual se debe realizar el siguiente cálculo:

1000 x 2000 = 2.000.000900 x 2400 = 2.160.000800 x 2800 = 2.240.000700 x 3200 = 2.240.000600 x 3600 = 2.160.000850 x 3000 = 2.550.000

Por lo tanto, el fabricante debería ofrecer un descuento de 150€ para maximizar su beneficio mensual.

Aprende más sobre matemática en https://brainly.com/question/25809832

LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor )

Answers

A' = (4,0)
B' = (4,4)

please solve this quick
9 times 11 = 0.818181...
Explain?

Answers

doesnt it equal 99?

1 22.8 ÷ 0. 92 =
2 34.08 ÷ 0.24 =
3 28.9 ÷ 0.85 =
4 7. 15 ÷ 0.05 =
5 210.21 ÷ 0.91 =




Please answer it​

Answers

Answer:

1. 24.7826087

2. 142

3. 34

4. 143

5. 231

if the answer wants number 1. rounded in tenths, put 24.8

if they want it rounded in hundreths, put 24.78

hope this helps

1) 24.78

2) 142

3) 34

4) 143

5) 231

hope u liked this answer

#keep learning

Solve the equation algebraically show work to support the answer
2/3x + 4 = 2

Answers

Answer:

2/3x + 4 = 2

or,3x+2+4=2

or,3x+6=2

or,3x=2-6

or,3x=-4

or,x=-4/3

x=-1.33

estimate a 15 tip on a restaurant bill of $24.55

Answers

Answer:

39.55

Step-by-step explanation:

24.99+15=39.55

That is how you get your answer :)

Answer:

1.89

Step-by-step explanation:

.15 x 24.55=1.89

20 POINTS!! PLEASE HELP DUE NOWWW!
Gia started to solve the equation 3(x − 10) − 5x = 2x − 26 below. They want to move the variables to the left side of the equation for their next step.


Fill in Line 4 and give the property.


Line 1: 3(x − 10) − 5x = 2x − 26 Original Problem

Line 2: 3x − 30 − 5x = 2x − 26 Distributive Property

Line 3: -2x − 30 = 2x − 26 Collect Like Terms

Line 4: _______________ _______________

Answers

The value of x from the given equation is -1

Given the equation expressed as:

[tex]3(x - 10) - 5x = 2x - 26[/tex]

Expand using the distributive law as shown:

3x - 3(10) - 5x = 2x - 26

3x - 30 - 5x = 2x - 26

Collect the like terms to have:

3x - 5x - 2x = -26 + 30

-2x - 2x = -26 + 30

Simplify the result by addition and subtraction:

-4x = 4

Divide both sides by -4 (Division property of equality)

-4x/-4 = 4/-4

x = -1

Hence the value of x from the given equation is -1

Learn more equations here: https://brainly.com/question/22688504

how would i plot this on a graph??

Answers

Step-by-step explanation:

This is in the form of

[tex]h(x) = y[/tex]

in this case, x is 1 and y is 7. So ourbpoint would be (1,7.)

Question:
Goofy Unlimited Lighting sells a 12 pack of lightbulbs for $8.40. Daisy Luminous Lighting sells a pack of 19 lightbulbs for
$15.35. Which store has the better deal. (3 points - 1 point showing the correct proportional relationship, 1 point
showing the unit rate, 1 point for identifying the store name)
es 0)
balo

Answers

Answer:

Goofy unlimited lighting 12 pack of light bulbs

Step-by-step explanation:

12 = 8.40/12 = .70 cents

19 = 15.35 = .81 cents


7 cm
rom
This quarter circle has a radius of 7 centimeters.
What is the area of this figure?
Use 3.14 for pi.
Enter your answer as a decimal in the box. Round your answer
to the nearest hundredth

Answers

[tex]▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪[/tex]

Area of quarter = 1/4 × Area of whole circle

that is ~

[tex] \sf \dfrac{1}{4} \times \pi {r}^{2} [/tex]

[tex] \sf \dfrac{1}{4} \times 3.14 \times 7 \times 7[/tex]

[tex] \sf \dfrac{153.86}{4} [/tex]

[tex] \sf \approx38.46 \: \: cm {}^{2} [/tex]

Tyrone works in a grocery store and he puts boxes on shelves. There are 4 shelves in the cereal section of the store. All shelves hold the same number of boxes of cereal. If there are 80 boxes of cereal on the shelves, how many boxes are on each shelf? In complete sentence

Answers

Divide 80 (the number of boxes) by 4 (the number of shelves) and you’ll get 20. There are 20 boxes of cereal on each shelf.

A statistics teacher has a large container of beads that she says contains 60% blue beads. A student randomly selects
50 beads. Let p = the true proportion of blue beads in the container. If the true proportion of blue beads is 0.60, which
value of ô is least likely to occur?
O 0.50
0.60
O 0.70
0.80

Answers

Answer:

0.80

Step-by-step explanation:

its the farthest away from 0.60

Other Questions
Pls help right answer gets brainliest A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President