Answer:
The correct answer is - add a few bases for DNA polymerase
Explanation:
A short extended nucleic acid composed of ssRNA molecule. This is a molecule that synthesize a primer initialy and later again lay down a primer after the opening of replication fork by DNA helicase.
It sysntheisze before and after the helicase and follow the helicase in order to prepare for the replication process. Thus, adding a few bases for DNA polymerase is main job of RNA primase.
Pls help :)) worth 10 points (:
Answer:
A
Explanation:
just go for A
3.4.3 Lab: Why are cells so small?
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic
Answer:
D
Explanation:
Please help I will give a brainliest
Answer:
answer
Explanation:
im not that good w these sorry
the combination of a heart arteries and veins and capillaries is____
Answer:
A (an organ system)
Explanation:
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
plz help me i beg of you!???
Answer:
Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.
Explanation:
Using the data in Figure 13.2, translate the following DNA segment into an amino acid sequence: -TTTAGCGAGTCTCGA-
Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over time is the position of whales nostris. The images below show the skills of a modern whale
and its ancestor, Pakicatus
Nostrils at front
of skull
Nostrils at top
of skull
Pakicetus
Eschrichtius
cientists think that the position of the nostrils gives modern whales an evolutionary advantage. Which of the following most likely describes how this adaptation is advantageous?
O The nostril position allows whales to obtain air more easily at the surface of the water.
The nostril position allows whales to obtain food more easily at the surface of the water.
O The space lett empty by the migrating nostrils has allowed modern whales to develop gills.
The space left empty by the migrating nostrils has allowed modern whales to develop teeth.
Answer: Its A my friend, how it helps!.
Explanation: I just completed the Test.
The nostril position allows whales to obtain air more easily at the surface of the water is most likely describes the advantage of adaptation.
What do you mean by adaptation?In biology, adaptation has three related meanings. It is the dynamic evolutionary process of natural selection that fits organisms to their environment, enhancing their evolutionary fitness. Secondly, it is a state reached by the population during that process.
The ability of living organisms to adjust themselves to their surroundings is called adaptation. Adaptations are the changes in structure or behaviour of an organism that will allow the organism to survive in that habitat.
Adaptations are unique characteristics that allow animals to survive in their environment. There are three types of adaptations: structural, physiological, and behavioral.
Learn more about adaptation:
https://brainly.com/question/12534888
#SPJ2
Clever ones this is one for you
If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.
Answer:
so please Indicate your question
Artificial selection applies only to dog breeding?
True OR False.
Answer:
Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.
true...?
Explanation:
Answer:
False.
Explanation:
The bananas we have today were created using artificial selection. Same thing with peanuts by the way.
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
Desert plants and animals are adapted to the lack of what and high
Answer:
lack of water and high concentration of heat and dryness
Explanation:
Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.
hope this helped:)
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used
Answer:
Pretty sure its b.
Explanation:
PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Answer:
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Explanation:
Hope This Helps!
Please Mark Me Brainly!
Apply: Which type of moth do you think was more common before the 19th century, when most trees were light in color?
Answer:
light moths
Explanation:
yes their were most light color in most trees
Light moths was more common before the 19th century, when most trees were light in color.
What are the functions of light moths?Insects, like moths, are drawn to bright lights because they make it difficult for them to navigate. It's a common sight, particularly in the summer: The lights, like lamps, were surrounded by moths and other insects.
Most nocturnally dynamic moths are drawn to light, a peculiarity known as sure phototaxis. However, because they are phototactic, some species, like the Old Lady (Mormo maura), tend to avoid it.
No one really knows why moths are drawn to light, but there are a few theories, and they also like the smell of fermented sugar and ripe fruit, which are both food sources.
Learn more about light moths:
https://brainly.com/question/14452844
#SPJ3
Is a seed a living organism
Answer:
Yes they are living organisms
Help I need helpppppppoo
And, what else it literally says CHECK ALL THAT APPLY like....
Answer:
i dont understand??????
Explanation:
Answer:
What??
Explanation:
This makes no sense to me...
What might be the consequences of your choice?
• Political:
• Economic:
• Social:
Answer:
Political: Lobbyists.
Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.
Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.
Explanation:
A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?
Answer:
Add magnet to the bowl, cover the bowl, and shake well
Explanation:
Anything with MAGNET
Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II
Answer:
Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8
Explanation:
I learned this a while ago so I would know
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as
Answer:
This organism is best classified as an autotroph.
Explanation:
Autotrophs can make their own food.
In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration
Answer:
D. In mitochondria, during cellular respiration.
Explanation:
A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.
All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.
Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.
Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.
In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.
Answer:
D
Explanation:
got it right on edge
(I will give a Brainliest) Can liquid water and steam exist at 100°C?
Answer: yes it can!
Explanation: hope you get a good grade!
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
I need help. Due today.
Answer:
D) common ancestry among vertebrate species
Lister cultured the bacteria responsible for milk spoilage.
True
False
Answer:
True
Explanation: