please help!!! i have been doing bad in math right now .

Please Help!!! I Have Been Doing Bad In Math Right Now .

Answers

Answer 1
1) You have to multiple 1/6 (getting 4 the first time) by 1/2 (number of times you can get an even number) to get 1/12

Hope this helps!!

Related Questions

Can someone help me with this??

Answers

Answer:

A

Step-by-step explanation:

When dilating an object, you multiply the x and y values by whatever scale you want to dilate the object by. It cannot be C because 2/5 is less than 1, which means that the object would shrink. So the answer must be A

Write an inequality for the statement the temperature is greater than 100°F

Answers

Tenperature greater than 100 oF
T > 100 oF

help! parallel, perpendicular, or neither?

Answers

Answer:

parallel

Step-by-step explanation:

Because a is pependicular to k

Parallel.

Hope that’s helpful :)

In a random sample, 3 of 400 computer chips are defective. Based on
the sample, how many chips out of 100,000 would you expect to be
defective?

Answers

Answer:

750 of 100,000 chips would be expected to be defective.

Step-by-step explanation:

(3/400) and (?/100,000)

100,000 ÷ 400 = 250.

Multiply 250 by 3 to find the number of defective chips.

250 x 3 = 750.

what is the answer to 7(2x + 9)

Answers

Answer:

14x + 63

Step-by-step explanation:

[tex]7(2x+9)\\\\14x+63\\\\\left \{ {{7*2x=14x} \atop {7*9=63}} \right.[/tex]

Hope this helps.

At the craft store, Amelia bought a bag of purple and yellow marbles. She received 75 marbles in all. 15 of the marbles were purple. What percentage of the marbles were purple?

Answers

Answer: 20%

Step-by-step explanation:

Given

Total marbles are 75

Out of this 15 are purple

Percentage of purple marbles is given by

[tex]\Rightarrow \dfrac{15}{75}\times 100=20\%[/tex]

So, purple marble constitutes of 20%

[AB] is a diameter of center C(O, 3cm). M is a point on (C) such that MA=MB. D is the symmetric of A with respect to M.
What is the nature of triangle AMB? Justify. ​

Answers

Answer:  I dont know AZ

Find the values of x and y that make these triangles congruent by the HL Theorem

Answers

Answer:

number 3

because because because because because because because because because

Step-by-step explanation:

because because because because

Please look at the picture and answer my question I need help!

Answers

Answer:

64oz=4lb

Step-by-step explanation:

When converting ounces to pounds there is a 16:1 ratio, or there is 16 ounces in every pound.

To solve this, simply do 64/16 and you'll get your answer of 64oz=4lb.

64/16=4

64oz=4lb

happy april fools day you nerds now take my points

Answers

Happy April fools day ?

Answer:

WOW THANK YOU SO MUCH!

Step-by-step explanation:

I'm more of a dog lover and not a nerd, but hey I'll take what I can get!

If your like dogs, can you guess what kind of dog this is?

(yes they are all the same breed just different coat colors)

Which of the following correctly completes the square for: x^2+2x=48

A. (x+2)^2=52
B. (x+1)^2=49
C. (x+2)^2=47
D. (X-1)^2=26

Answers

Answer:

(x+1)²= 49, the answer is B

Step-by-step explanation:

x² + 2x = 48

x² + 2x + (2/2)² -  (2/2)²= 48 --[what we are trying to do is to complete a square by adding (2/2)² -  (2/2)²]

(x+1)²= 49, the answer is B

Answer:

hey I'm pretty sure it's B. (x+2)²=49

Step-by-step explanation:

x²+2x+(2\2)²=48 + (2\2)²

(x+1)²=49

2 over 2 by the power of 2 = 1

help please !!!! (will give brainliest)

Answers

The answer is 18.8

Montana has a temperature of -0.7 so to get to 0 degrees you need to add 0.7. Once you get to zero you need to add 18.1 (Florida’s temperature) and then add 18.1 + 0.7 to get 18.8

Help, Help, Please
[tex] \sf find \: the \: value \: of \: \theta \: when \: \theta \: is \: acute\: angle[/tex]
[tex] \sf \cos^{2}(\theta) - \sin^{2}(\theta) =2-5 \cos(\theta) [/tex]
[tex]\text{note:explanation is a must}[/tex]

Answers

Answer:

θ = [tex]\frac{\pi }{3}[/tex] (60° )

Step-by-step explanation:

Using the identity

sin²x + cos²x = 1 ⇒ sin²x = 1 - cos²x

Given

cos²θ - sin²θ = 2 - 5cosθ

cos²θ - (1 - cos²θ) = 2 - 5cosθ

cos²θ - 1 + cos²θ = 2 - 5cosθ

2cos²θ - 1 = 2 - 5cosθ ( subtract 2 - 5cosθ from both sides )

2cos²θ + 5cosθ - 3 = 0 ← in standard form

(cosθ + 3)(2cosθ - 1) = 0 ← in factored form

Equate each factor to zero and solve for θ

cosθ + 3 = 0

cosθ = - 3 ← not possible as - 1 ≤ cosθ  ≤ 1

2cosθ - 1 = 0

cosθ = [tex]\frac{1}{2}[/tex] , so

θ = [tex]cos^{-1}[/tex] ([tex]\frac{1}{2}[/tex] ) = [tex]\frac{\pi }{3}[/tex] ( or 60° )

Answer:

[tex] \huge \boxed{ \boxed{\blue{ { \theta = 60}^{ \circ} }}}[/tex]

Step-by-step explanation:

to understand thisyou need to know about:trigonometryPEMDASlet's solve:[tex] \sf \: rewrite \: \sin ^{2} ( \theta) \: as \: 1 - \cos ^{2} ( \theta) : \\ \sf \implies \: \cos ^{2} ( \theta) - (1 - \cos ^{2} ( \theta)) = 2 - 5 \cos( \theta) [/tex][tex] \sf \: remove \: parentheses \: and \: change \: its \: sign : \\ \sf \implies \: \cos ^{2} ( \theta) - 1 + \cos ^{2} ( \theta)) = 2 - 5 \cos( \theta) [/tex][tex] \sf \: add : \\ \sf \implies \: 2\cos ^{2} ( \theta) - 1 = 2 - 5 \cos( \theta) [/tex][tex] \sf \: move \: left \: hand \: sides \: expression \: to \: right \: hand \: sides \: : \\ \sf \implies \: 2\cos ^{2} ( \theta) + 5 \cos( \theta) - 1 -2 = 0[/tex][tex] \sf \: rewrite \: 5\cos( \theta) \: as \: 6 \cos( \theta) - \cos( \theta) : \\ \sf \implies \: 2\cos ^{2} ( \theta) + 6 \cos( \theta) - \cos( \theta) - 3 = 0[/tex][tex] \sf \:factor \: out \: 2 \cos( \theta) \: and \: - 1 : \\ \sf \implies \: 2\cos ( \theta)( \cos( \theta) + 3 ) -1( \cos( \theta) + 3) = 0[/tex][tex] \sf \: group: \\ \sf \implies \: (2\cos( \theta) - 1) ( \cos( \theta) + 3 ) = 0[/tex][tex] \sf \: rewrite \: as \: two \: seperate \: equation: \\ \sf \implies \: \begin{cases}2\cos( \theta) - 1 = 0\\ \cos( \theta) + 3 = 0 \end{cases} [/tex][tex]\sf add \: 1 \: to \: the\: first \: equation \: and \: substract \: 3 \: from \: the \: second \: equation: \\ \sf \implies \: \begin{cases}2\cos( \theta) = 1\\ \cos( \theta) = - 3 \end{cases} [/tex]

[tex] \sf the \: second \: eqution \: is \: false \: \\ \sf because \: - 1 \leqslant \cos( \theta) \leqslant 1 \: \\ \sf but \: we \: can \: still \: work \: with \: the \: second \: equation[/tex]

[tex] \sf substract \: both \: sides \: by \: 2 : \\ \implies\frac{ 2\cos( \theta) }{2} = \frac{1}{2} \\ \implies\cos( \theta) = \frac{1}{2} \\ \therefore \: \theta \: = {60}^{ \circ} [/tex]

EXPLAIN YOUR WORK PLZ

AJ worked 48 hours last week. He earns $15.40 per hour plus overtime, at the usual rate, for hours exceeding 40 hours. What was his gross pay?
A $644.80
B$739.20
C$800.80
D$1,108.80

Answers

Answer:

D

Step-by-step explanation:

It will be $1,108.0 Because if you devide 40 by the hours, Plus the pay which is 15.40 You will get D

A 30 year fixed rate mortgage at 4.5% with principal of $150,000 has a monthly payment of $760 per month. After
30 years, what is the total amount spent on interest?
A) $6,750
B) $123,600
c) $156,750
D) $273,600

Answers

Answer:

A 30 year fixed rate mortgage at 4.5% with principal of $150,000 has a monthly payment of $760 per month. After

30 years, what is the total amount spent on interest?

A) $6,750

B) $123,600

c) $156,750

D) $273,600

Step-by-step explanation:

4w2 + 3W

- 1

5w - 2

Which expression represents the area in square feet that the homeowner will cover with fertilizer?

Answers

Question:

A homeowner is building a flower bed in the backyard. He plans to put a layer of fertilizer over the entire flower bed.

[tex]Length = 4w^2 + 3w - 1[/tex]

[tex]Width = 5w - 2.[/tex]

Which expression represents the area in square feet that the homeowner will cover with fertilizer?

Answer:

[tex]Area = 20w^3 + 7w^2 - 11w + 2[/tex]

Step-by-step explanation:

Given

[tex]Length = 4w^2 + 3w - 1[/tex]

[tex]Width = 5w - 2.[/tex]

Required

Determine an expression for the area

Area is calculated as:

[tex]Area = Length *Width[/tex]

[tex]Area = (4w^2 + 3w - 1) * (5w - 2)[/tex]

Expand

[tex]Area = 20w^3 + 15w^2- 5w - 8w^2 - 6w + 2[/tex]

Collect like terms

[tex]Area = 20w^3 + 15w^2- 8w^2 - 5w - 6w + 2[/tex]

[tex]Area = 20w^3 + 7w^2 - 11w + 2[/tex]

Which expressions are equivalent to this exponential expression?
6-10
6-4
06-6
0 66
0
1
0
O
1
36

Answers

Answer:

6*6=36

Step-by-step explanation:

6*6. 6 with exponent of 2=36

Together Mike and Sara ran 42 laps on the
track. Sara ran twice as many laps as
Mike did. Write a system of equations and
solve it to see how many laps they each ran.

Answers

Answer:

i dont know the system of equations since i only calculated it until i got the right answer but sara did 28 laps and mike did 14

The equation shown has an unknown number ⍰÷3/4=4/9

Answers

Answer:

9

Step-by-step explanation:

Ab and cd intersects at e, aec=5x+12 and deb=8x-3

Answers

Answer:

x = 5

Step-by-step explanation:

Angles DEB and AEC are vertical angles, so they are congruent, and their measures are equal.

8x - 3 = 5x + 12

3x = 15

An interior designer wants to place this bed in a home, and she is especially concerned about the headboard, which is 6 feet wide and 5 feet tall. She’ll place the headboard on a wall that is 7 feet wide and 9 feet tall. She needs to know the area of the space that will remain after she places the bed against the wall

Answers

Answer:

Step-by-step explanation:

Area of the Wall minus the Area of the headboard      

Area = length x width      in  this use tall as length and wide as width

Area Wall - Area Headboard  =  (Tall wall)(Wide wall)  -  (Tall head)(Wide head)

                 =  (9)(7) - (5)(6) feet

                 =    63 - 30  feet

                 =   ????                      I'll let you finish it

The area of the space that will remain after she places the bed against the wall is 30 feet².

What is Area?

Area is the entire amount of space occupied by a flat (2-D) surface or an object's shape. The area of a plane figure is the area that its perimeter encloses. The quantity of unit squares that cover a closed figure's surface is its area.

We have,

The headboard, which is 6 feet wide and 5 feet tall.

The headboard on a wall that is 7 feet wide and 9 feet tall.

So, Area of remaining space

= Area of the Wall - Area of the headboard      

= (9)(7) - (5)(6) feet

= 63 - 30  

= 30 feet²

               

Learn more about Area here:

https://brainly.com/question/27683633

#SPJ5

Is parallelogram BCDE a rectangle?

Answers

No, all lines should be equal considering that rectangles have 4 of the same right angles

how do you find the range of 0.3 0.9 0.2 0 0.7 0.9 0.4

Answers

You subtract the biggest number from the smallest number. So it would be 0-0.9=0.9

Simplify the expression to standard form

-2.5(-3+ 4n+8)

Answers

Answer:

-12.5-10n

Step-by-step explanation:

jjjjjjjvuvubibuvuvuvibibivi

Answer:

distribute to get:

7.5 -10n -20

-10n - 12.5

Complete the following equation <, >, or = 3.20_ 3.02

Answers

Answer:

Step-by-step explanation:

Complete the following equation using , or = 3.20 ___ 3.02 A.

The following equation 3.20 > 3.02

The local movie theater charges $13 for adult tickets and $7 for children’s tickets. Yesterday they sold 115 tickets and made $943. How many adult and children tickets did they sell?

Answers

Answer:

i need more info

Step-by-step explanation:

((will give brainliest)) What is the output of the function y = 12 + 3x if the input is 5.​

Answers

Answer:

y = 27

Step-by-step explanation:

The output is the value of y when x = 5

Substitute x = 5 into the function , that is

y = 12 + 3(5) = 12 + 15 = 27 ← output

output is 27

to solve you plug in the input into x and rewrite the equation as y=12+3(5) then you add 12+15 and get y=27

find the greatest Common factor Of the Monomials 14p^2, 21pq and 35q2 is?
Please Help :(​

Answers

Answer: the greatest common factor is 7

Step-by-step explanation:

Answer:

7

Step-by-step explanation:

Analyze: 30 + 11 when c=4

Answers

It would be 23 because 3(4) + 11 would convert to 12 + 11 giving you 23

Answer:

23

Step-by-step explanation:

3c + 11

3(4) + 11

12 + 11

23

1. What is the decimal equivalent of 3/
9? 0.2 0.3 0.4 0.5​

Answers

0,3 is the decimal equivalent of 3/9
Other Questions
Jane Industries manufactures plastic toys. During October, Jane's Fabrication Department started work on 10,400 models. During the month, the company completed 11,200 models, and transferred them to the Distribution Department. The company ended the month with 2200 models in ending inventory. There were 3000 models in beginning inventory. All direct materials costs are added at the beginning of the production cycle and conversion costs are added uniformly throughout the production process. The FIFO method of process costing is being followed. Beginning work in process was 30% complete as to conversion costs, while ending work in process was 55% complete as to conversion costs.Beginning inventory:Direct materials costs $20,000Conversion costs $11,100Manufacturing costs added during the accounting period:Direct materials costs $70,700Conversion costs $240,500What is the amount of direct materials cost assigned to ending work-in-process inventory at the end of October?a. $19,783b. $20,337c. $10,923d. $14,916 Let AB be the directed line segment beginning at point A(5 , 5) and ending at point B(19 , 16). Find the point P on the line segment that partitions the line segment into the segments AP and PB at a ratio of 5:2. The hypotenuse of an isosceles right triangle is centimeters longer than either of its legs. Find the exact length of each side. (Hint: An isosceles right triangle is a right triangle whose legs are the same length.) What is the difference between bullying and sexuaul harrasment? at least 2 sentences for BRAINLIEST Find the value of y from the above rhombusA. 2B. 3C. 7D. None of these Rewrite each of the following sentences in the affirmative form, using indefinite words.Example: No veo a nadie. -> Veo a alguien.1. Nunca juego al voleibol. -> 2. No tenemos ninguna idea. ->3. No omos a nadie en el jardn. >4. No dice nada. -> 5. No me gusta el bisbol tampoco. -> A/An _________ narrative starts at the beginning and reveals each detail as it happens. Which of the following points is in the solution set of y>-x + 5? A. (0,5)B. (1,3) C. (2,4) The audience is sympathetic to which type of character?| Alboo protagonistO antagonistO archetypeO stock what is this answer ASAP PLS HELP Most plant growth takes place in the ____________________ of the root Given the definitions of f(c) and g(x) below, find the value of g(f(5)).f(x) = 2x 10g(x) = x2 + 6x 8 Please help me with this question Need Help ASAP Thanks so much in advance... 1/3 + 1/2 and I am 5 years old Please somebody help me and solve this problem Rockys rock quarry has three different sized trucks. Each truck can hold three ba the shipping manger put three bags that each hold about 200 pounds. 3. How large was the Ming Dynasty compared to the Mongols? What issues might arise from this difference? Pls I need help thank you 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA