Particles in a medium through which a sound wave is traveling _____.

move in a circular motion
move back and forth
move up and down
move randomly

Answers

Answer 1

Answer: so it move randomly

A mechanical wave that can be heard as it moves through a medium, such as air, and temporarily displaces the particles of the medium either by rarefaction or compression. reflection The bouncing back of a wave when it hits a surface through which it cannot pass.

Explanation:

What is a wave made of changing electric and magnetic fields that carries energy through matter or through empty space?

A wave made of changing electric and magnetic fields that carries energy through matter or through empty space; transverse; example: light.

can you help me to?

Particles In A Medium Through Which A Sound Wave Is Traveling _____.move In A Circular Motionmove Back

Related Questions

The effect of genetic drift on a population that splits into two populations because of geographic isolation may be
A
emigration.

B
immigration.

C
divergent evolution.

D
convergent evolution.

Answers

The effect of genetic drift on a population that splits into two populations because of geographic isolation may be divergent evolution.

What impact does genetic drift have on a population?

Alleles or genotypes fix in populations as a result of genetic drift. Drift removes alleles, which increases homozygosity and the inbreeding coefficient. In species that experience repeated cycles of extinction and recolonization, drift is presumably prevalent.

How does the divergence of two populations change as a result of genetic drift?

Rare alleles may completely disappear, and the gene pool may also shrink. A population may eventually become genetically distinct from the original population as a result of such drift. Divergence, reproductive isolation, and ultimately speciation could result from this.

To know more about genetic drift visit:-

https://brainly.com/question/29764189

#SPJ1

Compare the patterns of results from your Punnett square for Problem 1 on Student Sheet 5. 1 with the results from the Ocean/ Lucy cross in ""Gene Combo. "" Why are they similar?

Answers

The Punnett square for Problem 1 on Student Sheet 5.1 and the results from the Ocean/Lucy cross in "Gene Combo" are similar because both involve the inheritance of a single gene with two possible alleles: dominant and recessive.

In Problem 1 on Student Sheet 5.1, the gene in question is for flower color in pea plants, with the dominant allele (P) causing purple flowers and the recessive allele (p) causing white flowers. The Punnett square shows that when two heterozygous plants (Pp) are crossed, the resulting offspring have a 3:1 ratio of purple to white flowers, consistent with the laws of Mendelian inheritance.

In the Ocean/Lucy cross in "Gene Combo," the gene in question is for fur color in mice, with the dominant allele (B) causing black fur and the recessive allele (b) causing brown fur. The cross between two heterozygous mice (Bb) results in offspring with a 3:1 ratio of black to brown fur, again consistent with Mendelian inheritance.

Both the Punnett square and the Ocean/Lucy cross follow the same basic principles of Mendelian inheritance, with the dominant allele masking the recessive allele in heterozygous individuals. As a result, the observed ratios of dominant to recessive phenotypes in the offspring are predictable and follow a specific pattern.

To know more about the Punnett square, here

https://brainly.com/question/14438101

#SPJ4

which feature does not apply to protists: group of answer choices they form a non-monophyletic group they form a monophyletic group they comprise many of the groups in the domain eukarya they are all eukaryotes they are mostly unicellular

Answers

They form a monophyletic group is not a feature of protists.

FeaturesThe first three kingdoms are well defined monophyletic groups, but the "Kingdom Protista" is not monophyletic; it comprises species that are more closely connected to members of other kingdoms than they are to other protists.An ancestral taxon and all of its offspring make up a monophyletic group, often known as a clade. A monophyletic group can be cut from the root with just one cut, but a non-monophyletic group requires two or more cuts.Humans, apes, and new world monkeys are an example of a monophyletic group since they all share the old-world monkeys as their most recent common ancestor.

For more information on protists kindly visit to

https://brainly.com/question/1626285

#SPJ1

1. Which of these characteristics would classify an introduced species as being invasive?
A. They can be grown easily
B. They have many natural predators
C. They take away resources from native organisms
D. They tend to not survive well with changes to a new environment

Answers

The answer is C. Invasive species take resources from native organisms “invading” their habitats

Answer:

A

Explanation:

A species is said to be invasive when the rate at which it is spreading and multiplying is higher than expected causing a negative effect on the natives of the habitat

What do you notice when the ripples reach the edge of the large container? What landform is this like? How does the small container change what the ripples do? Explain how the “barrier island” in your model protects the section of large container behind it.

Answers

The beach may extend over the mouth of a shoreline depression, such as a bay or estuary, away from the mainland due to landform longshore drift.

How do barrier islands develop?

As waves regularly deposit silt parallel to the shoreline, barrier islands are formed. These islands constantly move, erode, and grow as wind and waves change in response to local weather patterns and physical factors. They may perhaps totally vanish.

What are the fundamental components of a barrier island?

who proposed that a barrier island be viewed as the focal point of a much broader barrier island system made up of six major components: mainland, back-barrier lagoon, inlet and inlet deltas, barrier island, barrier, and barrier

To know more about landform longshore drift. visit :-

https://brainly.com/question/1727804

#SPJ1

describe the main differences between bacterial and eukaryotic transcripts. drag the appropriate items to their respective bins.

Answers

Bacterial transcripts are single-stranded and produced by the polymerase enzyme. They are relatively simple, consisting of just the coding strand of DNA.

Eukaryotic transcripts are double-stranded and produced by the polymerase enzyme. They contain both the coding and non-coding strands of DNA and are much more complex than bacterial transcripts.

Bacterial transcripts - single-stranded, produced by polymerase enzyme, consists of just coding strand of DNA

Eukaryotic transcripts - double-stranded, produced by polymerase enzyme, contains coding and non-coding strands of DNA

For more questions related to Transcripts, refer here:

https://brainly.com/question/14136689#

#SPJ11

Identify the correct formula for phosphorus and oxygen

Answers

The correct formula of a compound that has ten oxygen atoms and four phosphorus atoms is P4O10.

When both the reactants and products of a chemical reaction have an equal amount of atoms and charge of each chemical element, the equation for the reaction is said to be balanced.

Phosphorus pentoxide is created when phosphorus and oxygen combine (P2O5).

The reaction involved is : P4 (s)+5O2 (g)⟶2P2O5 (s)

Subscripts that appear after each element's symbol indicate how many atoms of that element are present in the compound.

(The letters P and O stand for phosphorus and oxygen, respectively.)

There are 4 phosphorus atoms and 10 oxygen atoms in all. Tetraphosphorus Decoxide is the name of the substance.

To know about formula

https://brainly.com/question/30168705

#SPJ4

The complete question is

What is the correct formula of a compound that has ten oxygen atoms and four phosphorus atoms?

What might the shape of the skull and the supraorbital height tell us about each species?

Answers

It describes the species' gender and its capabilities. It could also reveal the age of the species.

Australopithecus africanus is the species that the unidentified skull most closely resembles based on the activity. According on the data the measure of the undefined skull is almost little as the pan troglodyttes, while it's teeth resembled that of a humans. If the foramen magnum indicates the position of the spine in relation to the head, and thus whether the creature moved about on two legs or in another manner, then the position of the opening may indicate when our ancestors first adopted the upright, bipedal posture that is so frequently considered to be the hallmark of humanity.

Learn more about ancestors here-

https://brainly.com/question/15074135

#SPJ1

Automatically


d) State the null hypothesis for the experiment in Figure 1. Provide reasoning to justify the


claim that the change in the amino acid sequence in the modified RNA polymerase affected the


shape of the active site on the enzyme.

Answers

The null hypothesis for experiment 1 is that the replacement of an amino acid will not affect the experimental strain's maximal elongation rate.

What is a null hypothesis in simple terms?

Conjectures used in statistical tests, which are formal techniques for drawing conclusions or making decisions based on data, include the null hypothesis and the alternative hypothesis. The hypotheses, which are based on a sample of the population, are suppositions about a statistical model of the population.

The tests are essential components of statistical inference and are frequently used to distinguish between statistical noise and scientific claims when interpreting experimental data in science. "The null hypothesis is the assertion that is being tested in a test of statistical significance.

Learn more about null hypothesis

https://brainly.com/question/28920252

#SPJ1

Computer crime first appeared in the 1970s. Soon after, special protocols of digital investigation and evidence were needed because _____.


cybercriminals were really smart

digital data could be altered in different ways from nondigital data

computers were becoming more powerful

the Internet was invented

Answers

Computer crime first appeared in the 1970s. Soon after, special protocols of digital investigation/forensics and evidence were needed because b. Digital data can be altered differently than nondigital data.

How computer crime first appeared?

Unlike traditional physical evidence, digital data can be easily altered or destroyed without leaving any visible traces, which makes it challenging to preserve and present it as evidence in a court of law. Therefore, special protocols of digital investigation and evidence were developed to address these challenges and ensure the integrity of digital evidence.

This need arose because of the unique characteristics of digital data, not necessarily because cybercriminals were smart or because computers were becoming more powerful. The invention of the internet also played a role in the growth of computer crime, but it was not the sole reason for the need for special protocols of digital investigation and evidence.

To learn more about digital investigation/forensics , visit: https://brainly.com/question/14893776

#SPJ1

Answer:

digital data could be altered in different ways from nondigital data

Which demonstrates an insertion mutation of the sequence GGGCCCAAA?

a. GGGGCCAAA

b. GGGCCAAA

c. GGGAAACCC

d. GGGCCCAAAAAA

Answers

D is the answer D is the answer

Shortly explain the science behind gene therapy.

Answers

Explanation:

Gene therapy is a medical field that aims to treat genetic disorders by introducing or modifying genetic material within an individual's cells. The goal is to replace a missing or defective gene or to introduce a new gene to improve the function of a specific cell or tissue.

There are two main approaches to gene therapy: ex vivo and in vivo. Ex vivo gene therapy involves the removal of cells from a patient, modifying the cells outside of the body, and then re-implanting them back into the patient. In contrast, in vivo gene therapy directly delivers the genetic material to the targeted cells within the body.

Gene therapy can be achieved using various methods, such as viral vectors, which are modified viruses that can deliver the genetic material to cells. Other methods include using nanoparticles or directly injecting the genetic material into cells.

Although gene therapy has the potential to cure genetic disorders, there are still some challenges and risks associated with it, including the risk of immune reactions, unintended mutations, and the difficulty of delivering the genetic material to the appropriate cells. However, with ongoing research and development, gene therapy is becoming increasingly promising as a viable treatment option for a variety of genetic disorders.

Fill in the table with two pros and two cons of the corn farmer switching to the genetically modified insect-resistant corn

Answers

The two pros and two cons of the corn farmer switching to the genetically modified insect-resistant corn are shown below:

PROS                                                                      

1.) Genetically modified (GM) crops have been shown to be safe via study and usage, and they may potentially improve the safety of popular meals.

2.) GMO crops reduce food prices while increasing nutritional value, hence reducing global hunger.              

CONS

1) Human clinical trials have not established that genetically modified (GM) crops are safe for human consumption.

2) Plant genetic modification may result in changes to the food supply that introduce toxins or provoke allergic responses.

The Genetic Literacy Project reports that "the most recent data from the International Service for the Acquisition of Agri-biotech Applications (ISAAA) show that more than 18 million farmers in 29 countries, including 19 developing nations, planted over 190 million hectares (469.5 million acres) of GMO crops in 2019." According to the group, the crops are prohibited in a "majority" of European nations, as well as Russia. Nonetheless, most nations that prohibit the cultivation of Transgenic crops accept their import. Europe, for example, buys 30 million tonnes of GMO maize and soy animal feeds each year.      

Learn more about genetically modified corn:

https://brainly.com/question/29978368

#SPJ4                        

Ancient organisms that lived during closer time periods were more alike than organisms that lived in widely separated time periods. What evidence in the fossil record most directly supports this scientific claim?

A
Most fossils are dated indirectly, by inference from surrounding rock that has been directly dated.

B
The rocks that fossils are found in can be examined in order to infer what environments certain organisms existed.

C
Fossils found in adjacent rock layers are generally more like each other than fossils found in widely spaced layers.

D
If the rock layers in a certain location have not been disturbed by tectonic or other movement, the lowest layer was formed before the layers above it.

Answers

Fossils found in adjacent rock layers are generally more like each other than fossils found in widely spaced layers evidence in the fossil record .

Option C is correct.

Which fossils can provide evidence of evolution?

The remains or traces of ancient animals, plants, and other organisms that have been preserved are known as fossils. Fossils are crucial to the theory of evolution because they demonstrate that life on Earth used to be very different from what we see today.

What is the relationship between modern and ancient organisms?

Evolution is the process by which modern organisms have evolved from ancient ones. Population change over time is evolution. There have been a lot of different explanations for how species change over time, but the ideas that Charles Darwin first put out are the foundation of modern evolutionary theory.

Learn more about ancient organism:

brainly.com/question/1375688

#SPJ1

Please help me!!!!! Hurry!

Answers

Missense mutations result in the incorporation of a different amino acid into the protein, while nonsense mutations result in the formation of a premature stop codon, leading to a truncated and often non-functional protein.

What is the difference between missense and nonsense as types of substitution mutation?

In a missense mutation, a single nucleotide change results in a different amino acid being incorporated into the protein. This can have a range of effects, from no effect at all to a complete loss of function.

In a nonsense mutation, a single nucleotide change results in the formation of a premature stop codon, which truncates the protein before it is complete. This results in a truncated and usually non-functional protein.

Learn more about mutation:https://brainly.com/question/17130462

#SPJ1

What is a difference between systemic and pulmonary circulation?

A.
Systemic circulation carries deoxygenated blood to the body and pulmonary circulation carries oxygenated blood to the lungs.
B.
Systemic circulation carries oxygenated blood to the body and pulmonary circulation carries deoxygenated blood to the lungs.
C.
Systemic circulation carries oxygenated blood to the lungs and pulmonary circulation carries deoxygenated blood to the body.
D.
Systemic circulation carries deoxygenated blood to the lungs and pulmonary circulation carries oxygenated blood to the body.

Answers

Answer:

It's B!

Explanation:

Systemic circulation carries oxygenated blood to the body and pulmonary circulation carries deoxygenated blood to the lungs. This is the main difference between the two types of circulation. Systemic circulation is responsible for delivering oxygen-rich blood from the heart to the rest of the body, while pulmonary circulation is responsible for carrying oxygen-poor blood from the heart to the lungs, where it can be oxygenated and then returned to the heart.

It is not option C because systemic circulation carries oxygenated blood to the body, not the lungs. It is not option A because systemic circulation carries oxygenated blood to the body, not deoxygenated blood. It is not option D because pulmonary circulation carries deoxygenated blood to the lungs, not oxygenated blood.

Hope this helps! If not, I'm sorry! If you need more help you can ask me! :]

7 points for each answer and a brainliest yay!

All the scientific theories used to explain the formation of the solar system are

A. Outdated

B. Imaginative

C. Non-testable

D. Unacceptable

Answers

None of the above options are correct. The scientific theories used to explain the formation of the solar system are:

E. Testable and subject to ongoing refinement.

Theories such as the solar nebula theory propose that the solar system formed from a giant cloud of gas and dust that collapsed under its own gravity, eventually flattening into a disk from which the Sun and planets formed. Other theories propose different mechanisms for the formation of the solar system, but all are based on scientific observations and are subject to ongoing refinement as new evidence is discovered. These theories are not outdated, imaginative, non-testable, or unacceptable, but rather represent the current scientific consensus on how the solar system formed.

Link the regulation of breathing in humans to the three components of any homeostatic process (ASAP PLS)

Answers

Answer:

Homeostasis is the process by which the body maintains a stable internal environment despite external changes. It involves three main components: receptor, control center, and effector. The regulation of breathing in humans is linked to all three components of homeostasis.

Receptor: The receptor in this case is the chemoreceptors located in the carotid arteries and aortic arch. They detect changes in the levels of oxygen, carbon dioxide, and pH in the blood.

Control center: The control center is the respiratory center located in the medulla oblongata of the brainstem. It receives input from the chemoreceptors and sends signals to the effectors to maintain homeostasis.

Effector: The effectors in this case are the muscles involved in breathing, including the diaphragm and intercostal muscles. They are controlled by the respiratory center and adjust the rate and depth of breathing to maintain the appropriate levels of oxygen, carbon dioxide, and pH in the blood.

Overall, the regulation of breathing in humans is an important example of how the three components of homeostasis work together to maintain a stable internal environment in the face of changing external conditions.

Explanation:

Trinucleotide repeat disorders are hereditary diseases caused by mutant genes containing an increased number of repeats of a DNA trinucleotide sequence. Which sequence(s) contain a trinucleotide repeat? Select all that apply.
a)...CACGGAAGAAGAAGAAGAAATAGAC...
b)...AGCGACAGCAGCAGCAGCAGCAAGT...
c)...TTCACTGTCACTGTCACTGTCACTGTCC...
d)...CACGGCGGCGGCGGCGGCATCGC...
e)...GGCAGGCAGGCAGGCAGGCAGGCTG...

Answers

Trinucleotide repeat disorders are hereditary diseases caused by mutant genes containing an increased number of repeats of a DNA trinucleotide sequence. Therefore, the correct option is a, c, and e.

Which sequence(s) contain a trinucleotide repeat?

Trinucleotide repeat is a DNA sequence that is repeated several times in a row. A repeated sequence of three nucleotides that leads to a specific and consistent phenotype when it is repeated is known as trinucleotide repeats.Sequences containing a trinucleotide repeat are:

a) CACGGAAGAAGAAGAAGAAATAGAC, c) TTCACTGTCACTGTCACTGTCACTGTCC, and e) GGCAGGCAGGCAGGCAGGCAGGCTG.

Learn more about trinucleotide: https://brainly.com/question/2898576

#SPJ11

the largest criticism of the biological perspective is that it tends to vastly oversimplify systems that are in reality extremely complex. the tendency to do this is called:

Answers

The tendency to oversimplify complex systems is called reductionism.

Reductionism is a major criticism of the biological perspective, as it can often neglect the complexities of living systems.

Reductionism is a theory that states that a complex system can be reduced to its individual elements to better understand it. This means that complex things can be broken down into smaller, more simple parts.

This reductionist strategy is used by scientists to simplify complex scientific systems and make them more easily understandable by breaking them down into simple and distinct elements.

Because biological systems are complicated and multifaceted, they are difficult to understand and study. Reductionism is the biological perspective's strategy for dealing with this complexity and gaining a better understanding of how biological systems function.

The largest criticism of the biological perspective is that it tends to vastly oversimplify systems that are in reality extremely complex. The tendency to do this is called reductionism.

Know more about reductionism here:

https://brainly.com/question/3859361

#SPJ11

Invasive species have what affect on native populations when they exist in the same niche?

Answers

Answer: their population was affected

Explanation:

In a P generation of true-breeding tall plants that are crossed with true-breeding short plants, 100% of the F1 generation are tall. What does this suggest about short and tall alleles

Answers

If in a P generation of true-breeding tall plants that are crossed with true-breeding short plants, 100% of the F1 generation are tall, then this suggest that short is recessive while tall is dominant.

What are recessive and dominant alleles for a given phenotypic trait?

Recessive and dominant alleles for a given phenotypic trait are those that are masked or masked respectively the expression of the feature.

Therefore, with this data, we can see that dominant alleles are able to mask a particular feature in heterozygous individuals as obtained after a line pure cross.

Learn more about recessive and dominant alleles here:

https://brainly.com/question/3839594

#SPJ1

Why do we not see red, orange, and yellow colors in leaves during most of the year? a. During the rest of the year, the tree isn't conserving water. b. Accessory pigments are masked by chlorophyll most of the year. c. Cold weather is needed to stimulate accessory pigments to show off their c colors. d. The photoperiod needs to shorten in order to trigger the accessory pigments.

Answers

Because of its abundance, chlorophyll covers other pigments like xanthophyll and carotenoids that are yellow and orange in colour. Other pigments can be observed in leaves as the amount of chlorophyll decreases.

Why are red, orange, and yellow colours absent from leaves for the majority of the year?

You could believe that the orange and yellow hues, or pigments, are only present in leaves during the fall, but in reality, they are present all year long; we can just not see them because of the intense green pigment that is also present in leaves hides them.

Why are the yellow and orange colours not visible during the summer?

As I've mentioned in a number of my earlier pieces, leaves yellow and orange hues come to light when chlorophyll, the pigment that gives leaves their green appearance, is lost from the leaf. These pigments were hidden by chlorophyll in the summer.

to know more about pigments here:

brainly.com/question/24193152

#SPJ1

(URGENT HELP PLEASE) Which of the following does NOT support the theory of natural selection? *

There are species that live in North America that are not found in Australia


Humans have small bones at the end of our spine that resemble tail bones in other animals

Prehistoric mastodons are similar to today's elephants

Species that are similar to each other tend to live near each other

Answers

Answer:

arti nya apa wkwk

Explanation:

saya ngk bisa bahasa inggris

Describe the effect ht epassage of the natinal forest manegment act in 1976 had on the trend in logging between 1980s and early 2000s

Answers

The effect passage of National Forest Management, Plans for renewable resource management are required. Limits on logging were imposed, and loggers were required to keep out of national forests.

The National Forest Management Act (NFMA) of 1976 (P.L. 94-588) is a United States federal law that was enacted in 1976 as an amendment to the Forest and Rangeland Renewable Resources Planning Act of 1974, which called for the management of renewable resources on national forest holdings. The statute was enacted in response to challenges concerning different national forest operations, notably wood harvesting. Members of the Point Baker Association on Prince of Wales Island filed the case Zieske v Butz over the US Forest Service's first environmental impact assessment.

The complaint halted harvesting on 400,000 acres of the island's northwest tip, prompting the forestry sector to ask for Congressional action to overturn the lawsuit. Congressman Foley stated on the floor that six additional actions with rulings identical to Zieske v Butz were impeding logging.

Learn more about National Forest Management act :

https://brainly.com/question/15776732

#SPJ4

Complete question:

Describe the effect the passage of the National Forest Management act in 1976 had on the trend in logging between the 1980s and early 2000s.

if cell a has 48 chromosomes, how many chromosomes would be present in cell k?

Answers

If cell A has 48 chromosomes, the chromosomes would be present in cell K we cannot say how many chromosomes would be present in cell K because there is no definitive relationship between them.

Chromosomes are tiny structures within a cell's nucleus that contain genetic material in the form of DNA molecules. Each species has a specific number of chromosomes. The majority of human cells, for example, have 46 chromosomes. The chromosomes of a cell duplicate before the cell divides, ensuring that each daughter cell receives an identical set of chromosomes.

Therefore, the number of chromosomes in a cell is a distinct feature of the species or an individual, and it cannot be linked to another cell of the same or different species. Chromosomes can be used to identify different kinds of life and are an essential tool for biologists in their research.

Learn more about chromosomes at:

https://brainly.com/question/30993611

#SPJ11

What happens to biodiversity
when species are lost?
O biodiversity
O biodiversity
gets higher
stays the same
biodiversity gets lower
O nothing

Answers

Answer:

C, biodiversity gets lower

Explanation:

When species are lost, biodiversity gets lower. This is because each species plays a unique role in the ecosystem, and the loss of one species can have cascading effects on the rest of the ecosystem. As more species are lost, the complexity and resilience of the ecosystem decline, resulting in a decrease in overall biodiversity.

the so-called piltdown man was once considered an unusual and perplexing human ancestor, but it turned out to be the jaw of a young orangutan attached to a homo sapiens skull. what dating technique exposed the piltdown fraud?

Answers

The dating technique that exposed the Piltdown fraud was fluorine absorption dating. Flourine absorption dating is a relative dating technique used to determine the relative age of bones from ancient humans or animals.

The technique compares the levels of fluorine in bone from the same site, determining relative age based on these comparisons. This dating technique was used to expose the Piltdown fraud.According to a study published in Nature on November 21, 1953, the Piltdown man was discovered to be a forgery due to fluorine dating techniques. They used fluorine dating, a method of analyzing how much fluorine has penetrated fossil bones since burial. They found that the Piltdown remains contained less fluorine than any of the other materials they examined. This evidence showed that the skull and jaw could not have been buried together and indicated that the pieces of the skull had been artificially stained to match the colour of the jaw.The Piltdown man is one of the most prominent hoaxes in the history of science. The skull had been discovered in the early 20th century in Sussex, England, and had been presented as a crucial missing link between humans and apes. The scientific community was fooled for more than 40 years, until it was discovered that the skull was actually a forgery, made up of the jaw of a young orangutan and a human skull that was less than 1,000 years old.

Learn more about skull:  https://brainly.com/question/1491477

#SPJ11

=
7. Which is not a similarity between how
plants and animals use energy?
O Both plants and animals change food into
energy in the mitochondria.
O Both plants and animals require energy to
survive.
O Both plants and animals eat food and turn
it into energy.
O Both plants and animals break down food
into energy.

Answers

Answer:

Both plants and animals eat food and turn it into energy.

Explanation:

Plants cannot eat food because they use photosynthesis to make it, and they use the sun as one of the ways to get energy and not eating food.

through artificial selection, humans bred dogs from wolf ancestors. describe what type of selective pattern this represents to first get domesticated animals than different dog breeds. why this pattern? do not write artificial selection!

Answers

The selective pattern that humans bred dogs from wolf ancestors represents is "selective breeding.

Selective breeding is a type of selection pattern that was done intentionally by humans to create domesticated animals and different dog breeds. Selective breeding involves mating animals with specific traits in the hope of creating offspring with the desired traits. Humans have selectively bred plants and animals for thousands of years to produce desirable traits.

They used selective breeding to create a variety of domesticated plants and animals that are common today. The primary purpose of selective breeding is to create animals with desirable traits that are more suited to human needs or that can serve specific functions. It is the process of selecting specific traits by humans rather than natural selection.

Humans used such a pattern in breeding dogs from wolf ancestors. By selecting the desired traits in different wolves, humans over time created domesticated dogs. This selective breeding led to different dog breeds that possess unique characteristics like specific behaviors, shapes, sizes, and colors.

Learn more about ancestors: https://brainly.com/question/1234951

#SPJ11

Other Questions
one of the teachers _at school consider a bank policy to hold reserves equal to 15% of bank deposits. the bank currently has $25 million in deposits and holds $1 million of excess reserves. what is the required reserve on a new deposit of $500,000? please answer in dollars. Choose the expression that is equivalent to a fraction with four raised to the negative third power in the numerator and the quantity three raised to the negative second power times four squared end quantity in the denominator and the entire fraction is cubed 11. Let X 1 ,,X n,iidBeta(1,) and let Y n = 1in min X i and Z n = 1inmax Xi be the sample minimum and maximum of the first n observations. (a) Find the value b such that Yn pb. I need help with a c# assignment. I am using Visual Studios and need it done with basic c# coding. It is a GUI application.INSTRUCTIONSFor this assignment, you are required to create the GUI for a timekeeping/payroll system for CMS. The system should first allow an employee to enter his name and record the time he worked on each project for a given week. Using the spreadsheet above as a guideline, the system must allow the user to enter his name and the name of his supervisor. Next, the user must enter the number of the week for which he is entering time. Assume a maximum of 52 weeks in a year. Make sure the employee enters only a valid week number.To record an employees hours, the user must enter the name of a client, a clients contract, and a project. For each of the seven days in a week, the user must enter hours worked or check a box that indicates the day is a weekend, a holiday, or a vacation day. If the employee fails to enter any hours for a day and fails to check the weekend/holiday/vacation box for that day, the system should warn the user that the given day is missing information. The system should also ensure that if any work hours are entered for a day, the checkbox for that day should NOT be checked. Finally, the system should ensure that a user cannot enter more than 24 hours in a single day. Once the hours are entered, the user should be able to Submit his hours by clicking a button that will calculate his payroll information for the week and display it on the same screen.Payroll information is calculated as follows:All employees are paid for hours worked at a rate of $15 US dollars per hour. If the number of hours worked in the week exceeds 40, the employee is paid time and a half for his overtime hours. For example, assume an employee works 50 hours during a week, he will receive (40 X $15) + (10 overtime hours X (1.5 X $15)) = $825.00. If an employee works less than 40 hours in a week, the system should make note of this fact in a label beside the supervisors name. I tried a couple of calculations posted as answer but it is not the right answer. Please check the bold and Italic words. Thank you.Profitability AnalysisAlbion Inc. provided the following information for its most recent year of operations. The tax rate is 40%.Sales$100,000Cost of goods sold45,000Net income10,500Interest expense350Assetsbeginning balance120,000Assetsending balance126,000Preferred dividends$300Common dividends (paid December 31)$8,000Common shares outstandingJanuary 130,000 sharesCommon shares outstandingDecember 3140,000 sharesAverage common stockholders' equity$55,000Market price per common share$12Required:Round all answers to two decimal places except for dividend payout ratio which is rounded to four decimal places.1. Compute the following:a. Return on sales%b. Return on assets%c. Return on stockholders' equity%d. Earnings per sharee. Price-earnings ratiof. Dividend yield%g. Dividend payout ratio2. CONCEPTUAL CONNECTION: Assume you are considering an investment to provide retirement income. Based on the above, which would be of particular interest to you?Since all the ratios areprofitability liquiditysolvency leverage profitabilityratios, they should all be of interest to investors. Some, however, may be of more interest than others depending on the objectives of the potential investor. For an investor looking for an investment to provide retirement income, theearnings per share dividend yield ratio price-earnings ratio dividend payout ratio dividend yield ratiowould be of particular interest.Feedback AreaFeedbackReturn on Sales = Net Income / SalesReturn on Assets = [Net Income / [Interest Expense(1 Tax Rate)]] / Average Total AssetsReturn on Stockholders Equity = [Net Income Preferred Dividends] / Average Stockholders' EquityEarnings per Share = [Net Income Preferred Dividends] / Average Common SharesPrice-Earnings Ratio = Market Price per Share / Earning per ShareDividend Yield = Dividends per Common Share / Market Price per ShareDividend Payout Ratio = Common Dividends / [Income Preferred Dividends] Is doing the right thing and living by one's principles worth being put on trial for, at the risk of imprisonment, at the least? for socrates? for you? Three reasons I can give my friend in an essay not quit school to get married TUVW after a translation 2units left and a reflection over the y axis 9.Read this sentence from Passage 1."Given their size and durability, the pyramids must have been extremely challenging tobuild." (paragraph 5)Which sentence from Passage 2 shows the same idea?A "As to the building blocks themselves, up until recently, it was thought that thecumbersome stone blocks were carved from natural limestone." (paragraph 9)O"They were then moved by a tremendous amount of physical labor and carefully putinto place." (paragraph 9)"Finally, the stones fit together too perfectly to have been chiseled by hand."(paragraph 12)"Cast stones are no lighter than natural limestone." (paragraph 13)as Learning Company LLC. All Rights Reserved. Express the following relationships using the equation for the quantity theory of money. A. The money supply is given by nominal GDP divided by the velocity of money. P = MV / Y. M / P = Y / V. M = PY / V. Y = MV / P. B. The relationship of the money supply to the price level is the same as the relationship between real GDP and velocity. (Hint: Start by dividing the money supply by the price level. ) M = PY / V. Y = MV / P. P = MV / Y. M / P = Y / V. C. Real GDP is given by the flow of money divided by the price level. Y = MV / P. M / P = Y / V. P = MV / Y. M = PY / V. D. The price level of an economy can be found by dividing the product of the money supply and its velocity by real GDP. M / P = Y / V. M = PY / V. P = MV / Y. Y = MV / P 50 POINTS REALLY NEED HELP ASAP Please match the Supreme Court case with the correct descriptions. Question 5 options:Outcome: Led to the impeachment and resignation of a President.Was a case that confirmed the concept of Rule of Law, that the President is not above the law. Outcome: The Supreme Court determined that a ballot recount was NOT constitutional because the processes used were not consistent. Was a case that determined whether or not the 14th Amendment of Equal Protection was being upheld 1. U.S. v Nixon2. Bush v Gore Online communicators self-disclose at lower rates and share fewer emotions than they would in person.True?Falise? Alex and Sam both work for the same lawn-mowing service. The equation Y=20x gives the relationship between the amount Alex earns, y, by mowing for x hours. the table shows the amount Sam earns working different amounts of hours.How much more does alex earn per hour, in dollars, than sam?I NEED THIS ANSWER FAST! 20 POINTS POSSIBLE! what would justify america going to war with Russia today? question about the great Gatsby chapter 2:What is ironic about the way that Myrtle speaks of the lower-class servants such as the boy she had told to bring the ice? Please ASAP HelpWill mark brainlest due at 12:00 Do you believe that the concept of popular sovereignty supported by StephenDouglas was fair? Why or why not? a math teacher is assessing the manipulatives in his classroom prior to the beginning of the school year. it is most important that the manipulatives are: Which function is increasing?A. F(x) = 5^xB. F(x)=(0. 5)^xC. F(x) = (1/15)^xD. F(x)= (1/5)^x