Need help right now can’t figure it out

Need Help Right Now Cant Figure It Out

Answers

Answer 1

Answer:

[tex]\huge\boxed{Alkane.}[/tex]

Explanation:

The given compound is an alkane because all the bonds between carbon are single. Alkanes have all single bonds and are thus called saturated hydrocarbons.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

Related Questions

Which of the following statements is FALSE?

Answers

Answer:

I'll wait for some possible answers...

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

1. What is the major source of energy for the brain

Answers

Explanation:

glucose

The mammalian brain depends on glucose as its main source of energy. In the adult brain, neurons have the highest energy demand [1], requiring continuous delivery of glucose from blood.

hope its helpful to you #

The major source of energy for the brain is glucose. Metabolism of glucose provides energy to the brain.

What is the brain?

The brain is a body part that operates the various functions of the body. It is present in the head of the body. It is divided into two parts, the left brain, and the right brain.

Energy is something that is produced by the metabolism of food. Energy7 is required to carry out all the processes of the body. To walk, run, work, eat, everything requires energy.

The main source of the energy in animals and plants is glucose. The food we eat converts into energy by the process of respiration. The energy is transported into all parts of the body by blood circulation.

Thus, glucose is the major source of energy for the brain.

To learn more about energy, refer to the link:

https://brainly.com/question/781388

#SPJ2

What causes STI's & how are they transmitted?

Answers

Answer

I think the cause would be unprotected sex and well that would also be how its transmitted.

Explanation:

Why is it necessary for there to be variation in population in order for evolution by natural selection to occur?

Answers

Answer:

There needs to be variations in population in order for natural selection to occur because the entire point of evolution by natural selection is only the best variations will survive. So if there were no variations then there would be no natural selection because the animal's survival rate would be the same no matter how many times they reproduce because there are no different variations being introduced into the species. However, if there are variations then the animal's survival rate could be impacted because of the variations, for example, white mice would be easier to find for predators on a dark surface, while a darker mice would be harder to find for predators on a dark surface, thus, allowing the darker mice to prevail as they have a higher survival rate and the species will slowly evolve into the darker mice. But, if there were no evolution, in this case, then no matter what happens, the white mice would not be able to evolve into a darker mice because there are no such thing as variation. That is why it is necessary for there to be variation in order for evolution by natural selection to occur.

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?

Answers

Answer:

They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.

As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.

As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably?

Answers

Use resources responsibly and don’t waste resources for things you don’t need.

Most Americans/Canada say they hope to die __________.

Answers

i think they hope to die at home

current definition

please help​

Answers

Answer: now or like presently

Explanation:

I dont know

1. The burning of fossil fuels contributes to all of the following ecological problems except for:
A. ozone depletion
B. global warming
C. acid rain
D. air pollution

Answers

The burning of fossil fuels does not contribute to ozone layer depletion.

The burning of fossil fuels leads to the release of gases such as oxides of nitrogen, sulfur, and carbon as well as particulate matter such as smoke, ashes, etc.

The oxides released from fossil fuel burning can cause global warming (carbon dioxide), acid rain (SO2), and air pollution (particulate matter).

Ozone layer depletion is caused by pollutants such as halocarbons, solvents, etc.

More on ozone layer depletion can be found here: https://brainly.com/question/1285852?referrer=searchResults

Answer it correctly please

Answers

The first. One will be Guard cell

In which of these does a chemical change take place?
mixture
compound
solution
none of the above

Answers

Mixture because it’s reacting to a chemical change

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

How can carbon can be stored for a short time in the natural cycle?

Answers

Answer:

The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in rocks and sediments, while the rest is stored in the ocean, atmosphere, and living organisms.

Did you know that your bum can make three states of matter? Solid, Liquid, ad Gas

Answers

Answer:

Nope

Explanation:

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

thrips are insects that feed on rose

Answers

Answer:

????????????????????????


4. What is a function of the nucleus of an animal cell?
A. It is the place where energy is produced.
It stores the genetic information, the DNA (chromosomes).
C. It defends the cell from infections.
D. It captures sunlight to produce food.
5. Select a statement that best completes the phrase below. In a plant

Answers

Answer:

A. It is the place where energy is produced.

It stores the genetic information, the DNA (chromosomes).

Explanation:

What does fat become after the chemical process?

Answers

Answer:

uR mOtHeR

Explanation:

dUnno im sorry and very bored

After we eat food, the digestive system uses enzymes to: break proteins down into amino acids. turn fats into fatty acids. turn carbohydrates into simple sugars (for example, glucose)

g The hormone __________ induces is lipolysis, whereas the hormone __________ inhibits the process. insulin; norepinephrine glucagon; insulin insulin; glucagon epinephrine; adrenocorticotropic hormone epinephrine; glucagon

Answers

1)noradrenaline
2) adenosine

help please asap!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Basidiomycotes

the second one

Explanation:

Answer the following qs :
1- Mention three uses or benefits of fungi ?

Answers

Answer:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Explanation:

Humans use fungi for many purposes, including as food or in the preparation of food. Humans also use fungi for pest control. In addition, fungi can be used to produce citric acid, antibiotics, and human hormones. Fungi are model research organisms as well.

Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin

Please explain if possible!

Answers

Gram Positive :

Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.

The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :

Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.

Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :

Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.

If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :

The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.

Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :

Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."

Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :

a combining term that means "twisted" and is used to make composite words: streptococcus

Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :

Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.

Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :

On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).

The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :

Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.

Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:

Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.

Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.

Sources: ( https://www.cdc.gov/ )

2. In IVF the fertilization is : a) Always External b) Always Internal c) Can be any one of the two d) Fertilisation does not occur ​

Answers

Answer:

option a) is correct.

Explanation:

in IVF the fertilisation is always external.

IVF involves combining eggs and sperm outside the body in a laboratory.

An area that has been sampled to have a large population of organisms. Does this represent high biodiversity? Why or why not?

Answers

An area that has been sampled to have a large population of organisms is

regarded as having a high biodiversity.

Biodiversity is defined as the condition in which areas have a high amount

of plant and animal species present there. Any place with a large population

of organisms is said to have a high biodiversity while places with low

population of organisms have low biodiversity.

The stated facts therefore makes an area that has been sampled to have a

large population of organisms represents high biodiversity.

Read more on https://brainly.com/question/18727662

A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of

Answers

Answer:

Convergence

Explanation:

Which of the following does NOT happen during the light-dependent reactions of
photosynthesis?
ATP is produced
Oxygen is produced
Glucose is produced
NADPH is produced

Answers

Answer:

Glucose

Explanation:

Only glucose is produced in the light independent stage of the reaction

Why are there not many vaccines for fungal & parasite disease as we have for viral and bacterial disease?

Answers

Answer:

it is very easy to kill the pathogen by vaccination but it is very difficult to detoxify the toxins produced in the host.

Explanation:

Hopefully this helped!

what is chloride shift ​

Answers

The chloride shift is an exchange of ions that takes place in our red blood cells in order to ensure that no build up of electric change takes place during gas exchange.

Which phrase best describes what a soil horizon is?
A the bottom layer of a soil profile
B each layer of a soil profile
C the place where two soil profiles meet
D the place where a soil profile meets bedrock​

Answers

Answer:

I suppose the answer is C

Each layer of a soil profile best describes a soil horizon.

What is a soil horizon?

A soil horizon is a layer of soil within a soil profile. A soil profile is a vertical section through the soil, showing the different layers, or horizons, of soil that make up the soil. Soil horizons are typically classified based on their physical, chemical, and biological properties, and they can vary in thickness and composition depending on factors such as climate, vegetation, and the underlying geology.

Some common soil horizons include the surface horizon, the subsoil, and the parent material.

Learn more about soil horizon, here:

https://brainly.com/question/2416348

#SPJ5

Other Questions
4. Which of the following provides vitamins, minerals, carbohydrates, and fiber? Meat, vegetables, eggs, dairy products The author uses the gas station attendants warning to create tension by foreshadowing that. A number is les than or equal to -11 Which branch of science deals with the study of the structures shown here?FISHAMPHIBIAN REPTILEBIRD? helppppppppppppppppppppppppppppppppppppppp The length of a photograph is 6 inches less than little twice the width. The photograph is mounted in a frame that is 3 inches wide on all sides. If the area of the framed picture is 270 square inches, find the dimensions of the unframed photograph. I am 10 letters word, The first four 1234 has power to rule, You eat my 5678. My 89 and 10 means of a lady, Also I can fly what am i ???? An automobile with a mass of 1250 kg accelerates at a rate of 4 m/sec2 in the forward direction. What is the net force acting on the automobile? A rental car company charges $35 per day to rent a car and $0.15 for every mile driven. Enola wants to rent a car, knowing that:She plans to drive 450 miles.She has at most $260 to spend.Write and solve an inequality which can be used to determine xx, the number of days Enola can afford to rent while staying within her budget. Which of the following is equivalent to the expression below? (2^5)(2^6)(A) 2^11(B) 2^30(C) 4^11(D) 4^30 An airplane is 280 feet long. Charlie makes a scale model of the airplane at 1:140 of its actual size. How long is the model? Help pls, will give brainliestSimplify 2^3 x 2^18 Fiona is taking some time to balance her check register at the end of the month. Use the check register to answer questions for 6 and 7. Based on the transactions, what was the balance in Fionas account after she deposited her birthday gift on 6/4?$780$690$340$430 Pleaseee helpp! I dont understand!No linkssss What does Bilbo Baggins do at the end of hisbirthday party?O He disappears suddenly.O He sets off another round of fireworks.O He gives Frodo an expensive gift.O He eats and dances with the guests. plssssssssss help me Graph y= 73x+2. plz help ASAP I'll mark as brainliest What is the common ratio of the sequence?-2, 6, -18, 54,...A.-3B.-2C.3D.8 Proteins provide a lot of functions for your body. Choose a function of proteinsA. long term energyB. short term energyC. build muscle, hair, and nailsD. genetic information Question 6 of 10What are the best ways to appeal to an audience?