Need help 7-10 asap I’m stuck on these

Need Help 7-10 Asap Im Stuck On These

Answers

Answer 1

7. To show that VRHK is a square, one can observe that the opposite sides of the quadrilateral, VR and HK, are equal in length and the two adjacent sides, RH and VK, are also equal in length.

8. For VRHK to be a square, z must equal √2, so that VC = 6√2 and

VR = 12.

9. The length of RK is 12√2

10. The length of VK is 12√2

Give difference between sides and diagonal of square?A square is a two-dimensional, regular geometric shape with four sides of equal length and four angles of 90 degrees. The sides of a square are the four straight lines that make up the shape. The length of each side is the same as the length of the other three sides.The diagonal of a square is a line segment that connects two opposite corners of the square. The diagonal is not a side of the square, as it does not run along the same line as the other sides. The diagonal of a square is always the same length, which is the square root of the sum of the squares of the sides. This is known as the Pythagorean Theorem.The sides of a square are all equal, while the diagonal of a square is not equal to any of the sides. The length of the sides of a square is always the same, regardless of the size of the square, while the length of the diagonal of a square varies with the size of the square. The diagonal of a square is always longer than any of the sides, since it is the hypotenuse of a right triangle.

Solution:

8. We can solve this problem by using the Pythagorean Theorem. We know that the sides of a square are equal, so we can set up an equation using the theorem. VC = 6z, VR = 12, and we want the hypotenuse, VRHK, to be a square. VH² = VR² + RH² = 12√2.

VC = 6z = VH/2 = 12√2/2 = 6√2

6z = 6√2

z = √2

9. The length of RK' =  s√2 =12√2

To learn more about square refer to:

https://brainly.com/question/27307830

#SPJ1


Related Questions

20 ft
8 ft
20 ft
12 ft
Find the area

Answers

The area is 20 ft I know it is

Cylinders A and B are similar solids. The base of cylinder A has a circumference of 4π units. The base of cylinder B has
an area of 9π units.
The dimensions of cylinder A are multiplied by what factor to produce the corresponding dimensions of cylinder B?

4/9
2/3
3/2
9/4

Answers

Step-by-step explanation:

To find the factor by which the dimensions of cylinder A were multiplied to produce the corresponding dimensions of cylinder B, we can use the fact that they are similar solids. This means that the ratio of corresponding dimensions is the same for both cylinders.

Since the base of cylinder A has a circumference of 4π units and the base of cylinder B has an area of 9π units, we can use these measurements to find the ratio of the radii of the two cylinders.

The circumference of a circle is given by 2πr, where r is the radius, so the radius of cylinder A is 4π/2π = 2 units.

The area of a circle is given by πr^2, so the radius of cylinder B is sqrt(9π/π) = sqrt(9) = 3 units.

The ratio of the radius of cylinder A to cylinder B is 2/3. Since similar solids have the same ratio for all dimensions, this means that the dimensions of cylinder A were multiplied by a factor of 2/3 to produce the corresponding dimensions of cylinder B.

9. 15 onzas de frijoles enlatados por $2.25 88 $2.25 ÷ 15÷​

Answers

The price per ounce is given as follows:

$0.15 = 15/100.

How to obtain the price per ounce?

The price per ounce is obtained applying the proportions in the context of this problem, dividing the total price by the number of ounces.

The parameters for this problem are given as follows:

Total price: $2.25.Number of ounces: 15.

Hence the price per ounce is calculated as follows:

2.25/15 = $0.15.

Translation and missing information

The total price was of $2.25 for 15 ounces, and the problem asks for the price per ounce.

More can be learned about proportions at https://brainly.com/question/24372153

#SPJ1

In triangle MNO, Angle M is congruent to angle O. NO = 12 and OM=14. Find MN

Answers

The length of MN for this problem is given as follows:

MN = 12.

How to obtain the length of MN?

The law of sines states that the sine of each angle is proportional to the side length opposite the angle.

The angle opposite to side MN is given as follows:

O.

Which is congruent to angle M, and the side opposite to angle M is:

NO = 12.

Hence the length of MN is also given as follows:

MN = 12.

(as it is opposite to a congruent angle to the opposite side with length of 12).

More can be learned about the law of sines at brainly.com/question/4372174

#SPJ1

Average rate of exchange
50 points for answer and brainliest

Answers

Average rate of change of the function F (x ) = 9/ -2 (x)-7. Average rate is -3, 9

Explain about the Average rate?

The average rate at which one quantity changes in relation to another's change is referred to as the average rate of change function. A method that determines the amount of change in one item divided by the corresponding amount of change in another is known as an average rate of change function.

Divide the change in y-values by the change in x-values to determine the average rate of change. In order to determine changes in measurable parameters like average speed or average velocity, finding the average rate of change is extremely helpful.

f (x ) = -2

f (x) = 9/ -2 (-2)-7

      = 9 / 4 - 7

      =9 / -3

      = -3

f (x ) = -4

f (x) = 9/ -2 (4)-7

      = 9 / 8 - 7

      =9 / 1

      = 9

Average rate is -3, 9

To learn more about Average rate refer to :

https://brainly.com/question/24313700

#SPJ1

A group of people answer the question:

***How many times did you shop at

Ascobury's last week?"

Here are the results:

[5]

visits v frequency

fv

0

5

1

14

2

18

3

7

4

6

Find the mean number of visits.

Answers

Mean with frequency represented by the number of times people visits the shop is equal to 1.9.

Let 'v' represents the visits of the people.

'f' represents the frequency that is number of times group of people visits the shop.

To calculate mean results of the table are as follow:

Visits ( v)       frequency ( f)         fv

0                            5                     0

1                             14                   14

2                            18                   36

3                            7                     21

4                            6                     24

Mean of the number of visits

= ( Sum of all the fv ) / ( Sum of all the frequency)

= ( 0 + 14 + 36 + 21 + 24 ) / ( 5 + 14 + 18 + 7 + 6 )

= 95 / 50

= 1.9

Therefore, the mean of the number of visits with the given frequency is equal to 1.9.

The above question is incomplete, the complete question is :

A group of people answer the question:

How many times did you shop at Ascobury's last week?

Here are the results:

Visits ( v)       frequency ( f)         fv

0                           5

1                             14

2                            18

3                            7  

4                             6

Find the mean number of visits.?

learn more about frequency here

brainly.com/question/5102661

#SPJ4

The correct answer is 15

Answers

Is that a question? You don't seem to have anything linked or a question posted?

Solved by substitution

Answers

Answer:

32 & 12

Step-by-step explanation:

let age of andy = x

let age of brett = y

x + y = 44        (eq 1)

x= 8 + 2y         (eq 2)

putting the value of x from 2 in 1

8 + 2y + y = 44

3y = 36

y = 12

x = 8 + 2(12)

x = 32

Liling is making a quilt she starts with two small squares of material and custom along the diagonal then she arranges the four resulting triangles to make a larger square quilt block she wants the large quilt block to have an area of 36 square inches

Answers

Liling will end up with four triangles if she starts with two tiny squares of material and cuts them on the diagonal. Knowing the areas of each of the four triangles will help us calculate the size of the larger square quilt block.

We are aware that the area of a square can be calculated by multiplying one side's length by itself (A = s2). Each of the small squares' ensuing triangles has a base and height that are equal to one-half of its side because the small squares were cut on the diagonal. Therefore, each triangle has a surface area of (1/2) x (1/2) x s2 = (1/4) x s2 = (s2)/4.

If the large quilt block is made up of four of these triangles, then the area of the quilt block is 4 x (s^2)/4 = s^2. Since the area of the large quilt block is 36 square inches, we can set up the equation:

s^2 = 36

To find the length of one side of the large quilt block (s), we can take the square root of both sides of the equation:

s = √36

s = 6 inches

So, the length of one side of the large quilt block is 6 inches, and the area of the block is 36 square inches.

To learn more about area of square:

https://brainly.com/question/25092270

#SPJ4

12.2 Apples and Oranges
At the corner produce market, apples cost $1 each and oranges cost $2 each.
1. Find the cost of:
a. 6 apples and 3 oranges
b. 4 apples and 4 oranges
c. 5 apples and 4 oranges
8 apples and 2 oranges
Unit 3: Linear Relationships
Lesson 12: Solutions to Linear Equations
Download

Answers

Answer: a. $12, b. $12, c. $13, d. $12

Step-by-step explanation:

a. 1+1+1+1+1+1 = 6, 2+2+2=6, 6+6=12

b. 1+1+1+1=4, 2+2+2+2=8, 4+8=12

c. 1+1+1+1+1=5, 2+2+2+2=8, 5+8=13

d. 1+1+1+1+1+1+1+1=8, 2+2=4, 8+4=2

A condition associated with crossing multiple time zones is experienced by sports tourists from Argentina travelling to Japan list two ways for this condition before the flight

Answers

Jetlag is a condition associated with crossing multiple time zones is experienced by sports tourists from Argentina travelling to Japan.

People who travel quickly between different time zones may experience jet lag, a sleep disorder.

Jet lag causes sporadic sleep problems. It occurs when signals from a new time zone cause the body's biological clock to become out of sync. Feeding times and light exposure are two examples of cues.

The term "jet lag" originated from the fact that it was uncommon to travel far and quickly enough to cause desynchronosis prior to the development of passenger jet aircraft. Propeller-driven travel was slower and covered less ground than jet flights, so it had a negligible impact on the issue.

To learn more about jet lag: https://brainly.com/question/7336967

#SPJ4

M is the midpoint of LN. L has coordinates (1,12) and M has coordinates (-10,-4). Find the coordinates of N.

Answers

Answer:

N(-21,-20)

Step-by-step explanation:

We can apply midpoint formula to solve for endpoint (N):

[tex]\displaystyle{\text{Midpoint}= \left(\dfrac{x_1+x_2}{2}, \dfrac{y_1+y_2}{2}\right)}[/tex]

Let [tex]\displaystyle{x_1 = 1}[/tex], [tex]\displaystyle{y_1 = 12}[/tex] and Midpoint = (-10,-4). Therefore:

[tex]\displaystyle{\left(-10,-4\right)= \left(\dfrac{1+x_2}{2}, \dfrac{12+y_2}{2}\right)}[/tex]

Solve x with -10 and y with -4:

[tex]\displaystyle{\text{N}\left(x_2,y_2\right) = \left(\dfrac{1+x_2}{2}=-10, \dfrac{12+y_2}{2}=-4\right)}\\\\\displaystyle{\text{N}\left(x_2,y_2\right) = \left(1+x_2=-20, 12+y_2=-8\right)}\\\\\displaystyle{\text{N}\left(x_2,y_2\right) = \left(x_2=-20-1, y_2=-8-12\right)}\\\\\displaystyle{\text{N}\left(x_2,y_2\right) = \left(x_2=-21, y_2=-20\right)}\\\\\displaystyle{\text{N}\left(x_2,y_2\right)=\left(-21,-20\right)}[/tex]

Therefore, the coordinate of N is (-21,-20)

6. During the lunch hour rush, the number of vehicles
passing through the drive-thru at the Wendy's at
Appleby Line and Dundas has been determined to be
normally distributed with a mean of 38 vehicles and
a standard deviation of 5.7. What is the probability
that on a given day, exactly 35 vehicles pass through
the drive thru during the lunch hour rush?

Answers

Answer:

Step-by-step explanation:

To find the probability that exactly 35 vehicles pass through the drive-thru during the lunch hour rush on a given day, we can use the probability density function of the normal distribution. In this case, the mean is 38 and the standard deviation is 5.7.

The probability of a specific value x in a normal distribution is given by the formula:

P(x) = (1/(σ * √(2π)) * e^((-1/2) * ((x - μ)^2 / σ^2))

Where x is the specific value we are trying to find the probability of, μ is the mean, and σ is the standard deviation.

plugging in the given values, we get:

P(35) = (1/(5.7 * √(2π)) * e^((-1/2) * ((35 - 38)^2 / 5.7^2))

The result is very close to zero, the probability of exactly 35 vehicles passing through the drive-thru during the lunch hour rush is very low, almost impossible.

Find the quotient

-37. 44 = 4. 8

Check reasonableness by estimating:

-37. 44

4. 8

Estimated quotient:

Answers

-37. 44 / 4. 8 gives  -7.8 when dividing -37.44 by 4.8 by simple dividing rule whereas after rounding off -37.44 and 4.8 that will be -37 and 5 will be 7.4.

In the given problem Division is = 4. 8 and dividend is = -37. 44, And as per law Division is divided by dividend  (Division/dividend), and the result produced, is called quotient In this case in this case, Quotient is -7.8.

And -37.44 is approximately -37 As .44 is rounded off to .00 (As per law 0-4 is 0 and 5-9 is rounded up to the next digit. And 4.8 could be around off to 5. And now if -37 is divided by 5 estimated will be 7.4.

Learn More about division: https://brainly.com/question/25289437

#SPJ4

suppose the water depth during low tide at a certain bay is about 3.0 m, and at high tide it is about 9.0 m. the natural period of oscillation is about 12 hours, and on a particular day, high tide occurred at 4:45 a.m. find a function involving the cosine function that models the water depth d(t) (in meters) as a function of time t (in hours after midnight) on that day.

Answers

The function is d(t) = 6cos(πt/6 + π/4) + 6. It models the water depth in meters as a cosine function of time after midnight.

The amplitude of the cosine curve is the difference between the high and low tide water depths, which is 6 m. The period of the cosine curve is the same as the natural oscillation period, which is 12 hours. The high tide occurred at 4:45 a.m., so the phase shift is π/4.Therefore, the function is d(t) = 6cos(πt/6 + π/4) + 6.

The cosine function models the water depth d(t) in meters as a function of time t (in hours after midnight) on a particular day. The amplitude of the cosine curve is the difference between the high and low tide water depths, which is 6 m. The period of the cosine curve is the same as the natural oscillation period, which is 12 hours. The phase shift is π/4, as the high tide occurred at 4:45 a.m. Therefore, the function is d(t) = 6cos(πt/6 + π/4) + 6.

Learn more about function here

https://brainly.com/question/29633660

#SPJ4

select all histograms for which the median value is larger than the mean value. histogram a histogram b histogram c histogram d

Answers

Graphs (C) and (D) having median value larger than the mean value.

What Is a Histogram?

A histogram is a graphical representation of data points organized into user-specified ranges.

In graphs (C) and (D), the median value is larger than the mean value as the distribution is skewed to the left which means most values are large but there are few exceptionally small values because of which means shift towards the left and thus the mean is less than the median, or we can say that the median value is larger that the mean value.

So, graphs (C) and (D) having median value larger than the mean value.

To learn more about histogram visit : brainly.com/question/16819077

#SPJ4

The ancient Greeks thought that the most pleasing shape for a rectangle was one for which the ratio of length to width was 8 to 5. This ratio is called the Golden Ratio. If the length of a rectangular painting is 20 inches, determine the width of the painting in order for the length and width of the painting to have the Golden Ratio.

Answers

By applying the Golden Ratio rule, the width of the painting is equal to 12.5 inches.

What is a proportion?

In Mathematics, a proportion simply refers to an equation which is typically used to represent the equality of two (2) ratios.

This ultimately implies that, proportions is a mathematical operation which can be used to establish that two (2) ratios are equivalent and solve for all unknown quantities.

By applying the Golden Ratio rule, the width of the painting can be calculated as follows;

20/x = 8/5

Cross-multiplying, we have the following:

8x = 20 × 5

8x = 100

x = 100/8

x = 12.5 inches.

Read more on ratio here: brainly.com/question/27817533

#SPJ1

the rosebud flower shop has a basic delivery charge of 5$ plus a rate of 25 cents per mile. The beautiful bouquets shop has a delivery charge of $7 plus a rate of 20 cents per mile.

Answers

The price of the delivery is $15 and the mileage is 40.

What is the unitary method?

The unitary method is a method for solving a problem by the first value of a single unit and then finding the value by multiplying the single value. Unitary method is a technique by which we find the value of a single unit from the value of multiple devices and the value of more than one unit from the value of a single unit. It is a method that we use for most of the calculations in math.

Given that the rosebud flower shop has a basic delivery charge of 5$ plus a rate of 25 cents per mile.

Total cost = basic delivery fee + (rate per mile x number of miles)

=$5 + (0.25 x m)

= $5 + 0.25m

The linear expression that represents the total delivery cost from Rosebud Flower Shop ;

Total cost = basic delivery fee + (rate per mile x number of miles)

=$7 + (0.2 x m)

$7 + 0.2m

When the costs are the same, the two expressions would be;

$7 + 0.2m = $5 + 0.25m

$7 - $5 = 0.25m - 0.20

$2 = 0.05m

m = 2 / 0.05

m = 40

Price = $7 + 0.2(40)

$7 + 8 = $15

Learn more about the unitary method, please visit the link given below;

https://brainly.com/question/23423168

#SPJ1

Pls help me I am stuck on this thanks so much

Answers

Answer:

the twelve value will produce -3

Step-by-step explanation:

T(12) = 45 - 4(12)

T(12) = 45 - 48

T(12) = -3

Volume of Composed Figures What is the volume of this container?
15 cm 4,000 cm3 20 cm 6,000 cm3 10 cm 10 cm 900 cm3 20 cm 3,000 cm3 15 cm​

Answers

The volume of the container is 4,500 cm3.

Calculate the volume of the two cubes that make up the container.

For the cube on the left, the volume can be found by multiplying the length (15 cm) by the width (10 cm) by the height (10 cm).

15 cm × 10 cm × 10 cm = 1,500 cm3

For the cube on the right, the volume can be found by multiplying the length (20 cm) by the width (15 cm) by the height (10 cm).

20 cm × 15 cm × 10 cm = 3,000 cm3

Add the two volumes together to find the total volume of the container.

1,500 cm3 + 3,000 cm3 = 4,500 cm3

Therefore, the volume of the container is 4,500 cm3.

To know more about volume here

https://brainly.com/question/1578538

#SPJ4

Can someone please help me with this

Answers

hmmm proofs like these can be a bit circular kinda, let's do some rigamarole on the equations and we'll see if that works for a definition

[tex]\stackrel{\theta \textit{ is always in radian unit}~\hfill }{s=r\theta\implies \cfrac{s}{\theta }=r \hspace{5em}v=\cfrac{s}{t}\implies t=\cfrac{s}{v}\hspace{5em}\omega=\frac{\theta }{t}} \\\\[-0.35em] ~\dotfill\\\\ \omega=\cfrac{\theta }{t}\implies \omega=\cfrac{\theta }{~~ \frac{ s}{v } ~~}\implies \omega=\cfrac{\theta }{1}\cdot \cfrac{v}{s}\implies \omega=\cfrac{\theta v}{s}\implies s\omega=\theta v \\\\\\ \cfrac{s\omega}{\theta }=v\implies \cfrac{s}{\theta }\cdot \omega=v\implies \boxed{r\cdot \omega=v}[/tex]

Use the ALEKS graphing calculator to find all the zeros of the polynomial function.
g(x) = -2x² - 5x³+2x²+7x+1
Round to the nearest hundredth.
If there is more than one answer, separate them with commas.
zero(s):

Answers

The graph of the polynomial function g(x) = -2x² - 5x³ + 2x² + 7x + 1 is plotted and attached

The zeros are (-1.10, 0), (-0.15, 0) and (1.25, 0) to the nearest hundredth)

How to find the zeros of a polynomial function using graph

Using a graph is potted by written the equation on the plotter , the plotter interprets the equation and presents the graph

Zero of polynomial equation is the point where the y is zero this is solved by equating the polynomial function to zero

From the graph, the zeros are identified by the points where the graph cuts the the x axis.

Examining the graph of the function g(x) = -2x² - 5x³ + 2x² + 7x + 1 the zeros are

(-1.104, 0), (-0.145, 0) and (1.249, 0)

Learn more about polynomial graphs at:

https://brainly.com/question/9696642

#SPJ1

A ski resort is planning a year-end promotion by offering a Saturday night special for $109 per person. The high season rate for these rooms is $299. Management wants to hold some rooms for late arrivals that are willing to pay the high season rate. Assume the demand for the high season rate room is approximately normal with a mean of 50 and a standard deviation of 10.

(A) How many rooms should be set aside for full-paying skiers?

Answers

55 rooms should be set aside for full-paying skiers.

Now, According to the question:

Let C represents the contribution that is lost when a reservation is breached.

H represents the loss of opportunity that is associated with not having the availability of anything.

D rep the no- shows with regard to experience in the past

X represents the overbooked number.

All the values here represent the critical probability for yield management.

Let X rep the reserved seats for passengers with full fare

D rep the full fare tickets

F rep the price of full fare

D rep the price of discounted fare

Now, Solving the problem :

P(d< x) < (F -D)/ p × F

= (299 - 109)/0.8 × 299

=  71,012.5

The Z value for 0.71 probability is 0.5

U + Z* standard deviation = 50 + 0.5 *10

= 55 rooms

Learn more about Probability at:

https://brainly.com/question/11234923

#SPJ4

4. The two trapezoids below are similar. What
is the length of segment EF?
24 am
A
D
30 cm
B
C
G.
7.5 cm
X
E
H


Help please

Answers

The two trapezoids below are similar. The value of Ef will be 6.

What is the similarity?

If two objects are having the same shape then they will be termed as similar. So in mathematics, if two figures have the same shapes, lines or angles then they are called similar.

Given that there are two trapezoids ABCD and GHEF. The length of EF = x will be calculated as:-

Apply the similarity property in the two trapezoids.

AB / FE = DC / GH

24 / x = 30 / 7.5

x = ( 24 x 7.5 ) / 30

x = ( 1800 / 300 )

x = 6

Hence, the value of the side x = EF = 6.

To know more about similarities follow

https://brainly.com/question/14422880

#SPJ1

What is the height of the brick?

Answers

The height of the cube brick is 7 units and the volume is equal to 343 unit³

Volume of a cube

The volume of a cube is defined as the total number of cubic units occupied by the cube. The formula is given as V = a³ where "a" is the length of edge or sides.

The length of an edge for the cube brick is 7 units which implies the height represented by h is also 7 units and the volume is calculated as follows:

volume of cube brick = 7 units × 7 units × 7 units

volume of cube brick = 343 units ³

Therefore, the height of the cube brick is 7 units and the volume is equal to 343 unit³

Learn more about volume of cube here: https://brainly.com/question/1972490

#SPJ1

marcella owns a certain number of candles, and decides to start buying more to open up a candle shop. she decides to start buying 13 more candles a week. after 8 weeks, she has 160 candles. how many candles did she start with?

Answers

Marcella started with 56 candles during her initial purchase

The given problem can be solved by arithmetic approach

Given,

After 8 weeks she has 160 candles

And also, she buys 13 more candles every week

To find her initial number of candles purchased,

Let her initial number of purchase of candles be 'x'

According to the question,

Initial number of candles + (8 weeks * 13 candles/week) = 160 candles

Substituting x, we get

x+(13*8)=160

or, x+104=160

or, x=160-104

or, x=56

Thus, we can say that initially Marcella had bought 56 candles.

To know more about arithmetic problems, visit brainly.com/question/29271423

#SPJ4

Recall that in a 45 – 45 – 90 triangle, if the legs each measure x units, then the hypotenuse measures x units

Answers

The hypotenuse of the 45-45-90 triangle measures x / √2 units.Identify the given information. The given information is that the legs of a 45-45-90 triangle each measure x units. The question can be solved by following the steps :

1. Use the Pythagorean Theorem to solve for the hypotenuse. The Pythagorean Theorem states that a2 + b2 = c2 where a and b are the legs of the triangle and c is the hypotenuse. In this case, x2 + x2 = c2.

2. Simplify the equation. When two of the same numbers are added together, the sum is twice that number. Therefore, 2x2 = c2.

3. Solve for c. To solve for c, divide both sides of the equation by 2. This yields x2 = c2 / 2.

4. Take the square root of both sides. Taking the square root of both sides yields x = c / √2.

5.The answer to the question is that the hypotenuse of the 45-45-90 triangle measures x / √2 units.

To know more about Theorem here

https://brainly.com/question/30066983

#SPJ4

PLEASE PLEASE HELPPP

Answers

2/8 should be the slope intercept form because,starting at the point 0,5 we can go up 2 and go across 8 to find the answer of 2/8.

=
Quadrilateral N' is the image of quadrilateral N under a dilation.
A
B
N
OG
IN
D

Answers

The center of dilation if Quadrilateral N' is the image of quadrilateral N under a dilation is; Point C

What is the center of dilation?

The center of dilation is defined as a reference point that is used to appropriately scale the dilation of a figure.

Now, if we imagine that the corresponding vertices of the two quadrilaterals are extended, then it will be clear that the extensions intersect at a point C.

Therefore we can conclude that point C is the center of dilation by the fact that corresponding parts of a paragraphic intersect at a point.

Read more about center of dilatio at; https://brainly.com/question/3457976

#SPJ1

Find the slope of a line perpendicular to the line whose equation is 4x+5y=35Fully simplify your answer.



Answers

The slope of a line perpendicular to the line is 5/4

What is the slope of a straight line?

A straight line of the form

y = mx + c

has its slope as 'm'

It is constant for a line. The more the slope is, the steeper the line is.

Sign convention takes bottom left to top right going line as positive sloped. And that line which goes from bottom right to top left is taken to have negative slope. Horizontal line has 0 slope and vertical line has infinite slope, as it is now at maximum steepness.

If two lines are perpendicular, their slopes are negative reciprocals, which means that their product is -1

Given;

4x+5y=35

We can write the equation as;

4*x + 5*y - 35  = 0

5*y  = - 4*x  + 35     or    

y  = -(4/5)*x  + 35    

m= -4/5

 

So, now the slope of this line is -4/5 and line perpendicular slope will be 5/4

Learn more about slope here:

https://brainly.com/question/2503591

#SPJ1

Other Questions
find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false The key idea of John Locke's Enlightenment theory was to protect and enhance the freedoms and rights of O the government. O the philosophers. O the law. O the individual. A group of four friends spends a day at a local theme park, which has just opened a new attraction with very popular rides featuring new technology. They board one of the rides after waiting for over an hour in line, but about five minutes into the ride the electricity fails, and they are stuck on the ride for a half hour. When the ride finally resumes and concludes, they go to the theme parks guest services department to complain. What are the facts?How does the guest feel?How would you acknowledge the guests feelings?What would be your solution?How would you follow up with the guest? Read this quotation from paragraph 10."What could happen if you allowed yourself to step outside the cages and breathe in the fresh air of your freedom?"Based on the quotation, the author views her high-school years as a source of - A. transitionB. confinementC. orderD. discipline all of the following statements regarding the gulf war of 1991 are true except that select one: a. the united states suffered relatively few casualties in the war. b. the allied ground offensive focused on dislodging iraqi forces dug-in along the kuwait border. c. almost all islamic and arab nations joined a trade embargo against iraq. d. the united nations voted in favor of american policies toward iraq. e. the allied forces ultimately numbered 690,000 troops. a network administrator notifies a technician that the company is experiencing a ddos attack. several internal windows pcs are the source of the traffic. the network administrator gives the technician the windows computer names and states they be scanned and cleaned immediately. with which of the following types of infections are the pcs most likely infected? (select two.)