Make a claim for reasons
a
not to build homes and roads on a wetland.

Answers

Answer 1

Answer:

floods

Explanation:

if your in the wetlands then it probably floods pretty bad so you don't want to build there


Related Questions

A student is designing a device for humans to communicate through detectable light. Which waves should the student use from the electromagnetic spectrum? A X-ray waves B visible waves C infrared waves D ultraviolet waves

Answers

A.it should be a x-ray waves

What is the mRNA that would be transcribed from this strand of DNA?

Answers

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

A divergent boundary at two oceanic plates can result in a
-mid-ocean ridge
-volcanic island arc
-continental volcanic arc
-subduction zone

Answers

The answer is -volcanic island arc.

Effects that are found at a divergent boundary between oceanic plates include: a submarine mountain range such as the Mid-Atlantic Ridge; volcanic activity in the form of fissure eruptions; shallow earthquake activity; creation of new seafloor and a widening ocean basin.

25 POINTS
Check all the continents below that experienced an increase in average annual temperature.

Europe

Africa

North America

South America

Antartica

Australia

Asia

Answers

Answer:

Europe, North America and Asian:

Which of the following would not be found in blood serum? (2 points)

Antibodies
Platelets
Nutrients
Wastes

Answers

Answer: The answer is (B) Platelets. You wouldn't find Platelets in blood serum.

Explanation:

Using the 10% rule when studying trophic pyramids, if the autotrophs produce 100 joules of energy, how much energy is passed on to the herbivores?

A: 15 Jouls
B: 10 Jouls
C: 0.1 Jouls

Answers

The answer is
B- 10 jouls

Compare how energy is used worldwide with how it is used in the United States.

Answers

Answer:

the U.S comsumes almost 15% of the worlds energy

Explanation:

yes

Which of the following can cause damage to blood vessels if not treated?
hypertension
smoking
obesity
genetics

Answers

Answer:

hypertension

Explanation:

because high blood

Answer:

hypertension

Explanation:

High blood pressure is a major risk factor for cardiovascular disease.

Is Turritopsis dohrnii capable of bioluminescence?
A. Yes Turritopsis dohrnii is capable of bioluminescence.
B. No Turritopsis dohrnii is not capable of bioluminescence.

Answers

Answer:

A. Yes Turritopsis dohrnii is capable of bioluminescence.

Explanation:

Label what each letter means (photosynthesis)

Answers

Answer:

A- sunlight B-Oxygen C-carbon dioxide emission

Explanation:

Which international organization had the goal of ending smallpox?
A.World Health Organization
B. Organization of American States
C.World Trade Organization
D. North Atlantic Treaty Organization
E.US Olympic Committee

Answers

Answer: World Health Organization.

Explanation:

True or False? A forest of conifers holds more living matter than tropical rainforests.

A. True

B. False

Answers

Answer:

true

Explanation:

The statement "a forest of conifers holds more living matter than tropical rainforests" is definitely true.

How do coniferous forests differ from tropical rainforests?

Tropical Rainforests undergrowth is evenly distributed. Not much plant growth as very little sunlight passes through the canopy and reaches the forest floor, But coniferous has little undergrowth due to the low amount of sunlight received and the low soil nutrient.

The tropical rainforests have higher and large heights of trees and other vegetation. Due to this, other living matter must definitely be inhibited due to the absence of sunlight.

While in conifers, the height of trees and other vegetation is shortly limited, due to which other living matter also receive a high amount o sunlight. As a result of this, they grow and reproduce successfully.

To learn more about Tropical rainforests, refer to the link:

https://brainly.com/question/1146251

#SPJ2

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes.

2.

A tetrad is made up of

A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids.

3.

Which of the following statements about crossing over is TRUE?

A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above

4.

Crossing-over occurs during prophase I of meiosis.

A) True
B) False

5.

Crossing-over allows the reassortment of linked genes.

A) True
B) False

Answers

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.

B) sister chromatids of homologous chromosomes.

C) sister chromatids of non-homologous chromosomes.

D) non-sister chromatids of homologous chromosomes.

E) non-sister chromatids of non-homologous chromosomes. ✓

During meiosis, the two chromosomes in each parent,swipe their place resulting in a hybrid new genetic material

2.A tetrad is made up of

A) four non-homologous chromosomes.

B) four non-homologous chromatids.

C) four homologous pairs of chromosomes.

D) two homologous pairs of chromosomes.

E) two homologous chromosomes, each consisting of two chromatids.

Tetrad is a group of four chromatids formed in pachytene stage of meiosis

3. Which of the following statements about crossing over is TRUE?

A) It occurs only in males.

B) It occurs only in some chromosomes.

C) It occurs only between genes that are heterozygous.

D) It results in reduced genetic variation among gametes.

E) None of the above

The process of crossing over takes place between homologous chromosomes to increase genetic diversity

4.Crossing-over occurs during prophase I of meiosis.

A) True ✓

B) False

crossing over helps in genetic variation and occurrs between prophase 1 & metaphase 1

5. Crossing-over allows the reassortment of linked genes.

A) True

B) False

Crossing over helps in the reassortment of non-sister chromatids of non-homologous chromosomes
A crossover in meiosis is an exchange of genetic material between non-sister chromatids of homologous chromosomes. Thus, the correct option for this question is D. A tetrad is made up of two homologous chromosomes, each consisting of two chromatids. Thus, the correct option for this question is E. The statement which is true about crossing over is none of the above. This is because the process of crossing over occurs between homologous chromosomes. Thus, the correct option for this question is E. The statement "the process of crossing over occurs during prophase I of meiosis" is definitely true. The statement "Crossing-over allows the reassortment of linked genes" is definitely true.

What is Crossing over?

Crossing over may be defined as the process through which the exchange of genetic material between homologous chromosomes takes place that results in the mixture of parental characteristics in the offspring.

According to the context of this question, the process of crossing over takes place during the Pachytene stage of meiosis which significantly involves the reassortment of linked genes.

Therefore, each of the given questions is well answered above.

To learn more about Crossing over, refer to the link:

https://brainly.com/question/927405

#SPJ2

The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by
the action of
(A) decomposers
(B) producers
(C) primary consumers
(D) secondary consumers

Answers

Answer:

A

Explanation: Just what decomposers do, break down organic and sometimes inorganic material

The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by the action of decomposers. Thus, the correct option is A.

What is the Environment?

The Environment may be characterized as anything which is present in the surrounding of any living organism. The term "Environment" was given by Carlyle.

Decomposers are organisms that can significantly have the capability to break down dead, decaying organisms that remarkably contain organic as well as inorganic material in their body composition.

Such types of organisms convert dead and decaying matter into humus. They are also known as detrivores.

Producers are those that can synthesize their own food with the help of sunlight through the process of photosynthesis. While primary consumers are those that directly deed on the producers. They are also known as herbivores.

Therefore, decomposers are living organisms that perform the action of converting all organic and inorganic materials of the living organisms into the environment.

To learn more about Decomposers, refer to the link:

https://brainly.com/question/380333

#SPJ6

Which of the following is the strongest conclusion to an informative essay about Sherlock Holmes's strongest character traits as a detective?

A. In conclusion, Sherlock Holmes's drive to find answers and his observation skills led to his success as a detective. Plenty of readers admired this detective and went on to become detectives, too. While none were as famous as Holmes, many joined him in saying, "It's elementary, Watson!"

B. In summary, Sherlock Holmes was determined to find answers, no matter what.
He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

C. To conclude, Sherlock Holmes became a detective so that he could use his character traits for good. He searched for answers in The Mystery of the Lost Gem, even when Mrs. Blakely doubted him. Sherlock's drive to find answers was rewarded at last.

D. To summarize, Sherlock Holmes's character traits led to his success as a detective. Many readers admired this detective and tried to imitate him, even going so far as to say, "It's elementary, Watson!"

Answers

The strongest conclusion to this informative essay about Sherlock Holmes is: B. In summary, Sherlock Holmes was determined to find answers, no matter what. He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

What is an informative essay?

An informative essay can be defined as a literary work that presents factual information about an event, people, places or things.

This ultimately implies that, the main purpose of an informative essay is to provide sufficient information and explanation about an event, object, person (individual), places, or phenomenon to the readers (audience).

In this context, Sherlock Holmes's strongest character traits such as his five senses, as a detective should be highlighted or presented to the readers (audience).

Read more on informative essay here: https://brainly.com/question/19949636

The____focuses the light


lens

pupil

retina​

Answers

I think it Pupil? Because the light helps us see color by the reflection of the sun?

If allowed to grow naturally, minerals will form:

conglomerates
layers
rocks
crystals​

Answers

Answer:

D.) crystals

Explanation:

have a good day :)

Answer:

crystals​

Reason :

Crystals occur in nature when particles cluster to solidify as a liquid cools down and solidify. This is referred to as crystallization, and it can occur when molten solidifies or when liquid evaporates from an organic combination.

Which statement best describes the relationship between cellular respiration and photosynthesis?

a.Cellular respiration and photosynthesis have the same products but use different reactants.

b.Cellular respiration and photosynthesis are the same processes; one occurs in animal cells and the other in plant cells.

c.Cellular respiration produces oxygen, which is the reactant required for photosynthesis.

d.Cellular respiration produces carbon dioxide, which is the reactant required for photosynthesis.

Answers

i’m thinking it would be c

S-waves can move through both solid and liquid substrate.
A. True
B. False

Answers

Answer:

B. False

Explanation:

Why can't S-waves move through both solid and liquid substrate? The reason why is that only solids can be traversed by S-waves. This is due to the fact that liquids and gases do not resist altering shape.

An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.

Answers

Answer:

B

Explanation:

there are complex feeding mechanisms at work to protect the other species in the food web

Penelope is adding fractions while taking a math test. What part of her brain is at work?
spinal cord
cerebrum
cerebellum
hypothalamus

Answers

Answer:

Cerebrum

Explanation:

The cerebrum is the part of the brain that includes the hippocampus, which is responsible for solving math problems.

Answer:

cerebrum

Explanation:

edge 2022

8. In
In the
rock Cyce, igneous, sedimentary
and metamorphic
become magma again.
How does this happen?



Earth science

Answers

Answer:

Over millenia, these rocks get pushed back into the Earth's mantle, and get pushed into a volcano heating it up and turning it into magma.

Explanation:

Magma is molten rock, meaning existing rocks must be getting melted, the way the melting happens is by the rocks getting pushed into the ground by landforms and penetrating the mantle, this is how the cycle starts all over again.

- Explain the differences in growth between animals and plants

Answers

Answer:

The differences are given below

Explanation:

Plants differ from animals in their manner of growth. As young animals mature, all parts of their bodies grow until they reach a genetically determined size for each species. Plant growth, on the other hand, continues throughout the life span of the plant and is restricted to certain meristematic tissue regions only.

Which environmental change would most likely result in bullfrog offspring that are able to store more water than bullfrogs in previous generations?
A.
a dry season that lasts for a month
B.
flooding that turns the valley into a lake
C.
a drought that lasts for a very long time
D.
a rainy season that lasts for a month

Answers

Answer:

C.

a drought that lasts for a very long time

If the side of a cubical cell doubled, what would the cell then require? Select all the correct answers.

A. eight times more nutrients
B. to excrete eight times more waste
C. four times more nutrients
D. to excrete four times more waste

Answers

Given what we know, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

Why would the cell require more nutrients?

This has to do with the ratio between surface area and volume. Since volume is squared when calculating it, the volume of a cell increases much more rapidly than that of its surface area. So a cell that doubles in size would quadruple in volume, needed four times as many nutrients to maintain its internal processes.

Therefore, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

To learn more about cells visit:

https://brainly.com/question/5763151?referrer=searchResults

Which one of the following is the softest?

(A) Aluminium

(B) Iron

(C) Lithium

(D) Sodium

Answers

Answer:

Sodium

Explanation:

Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .

Name the chemical that helps in providing the ideal pH for pancreatic amylase to function in the human body.*​

Answers

Answer:

What is the chemical that helps in providing the ideal PH for pancreatic amylase to function in the human body?

Explanation:

This allows the protein lipase to break down and digest the fat in the small intestine much more quickly. The pancreas secretes bicarbonate to neutralize the acidity of chyme and pancreatic amylase to aid in the digestion of carbohydrates.

biology The studly of cells is called what​

Answers

Answer:

Cytology is the study of cells as fundamental units of living things.

6-10 Importance of planting​

Answers

Answer:

Importance of Planting

Explanation:

Trees increase property values.

Trees clean the air.

Trees slow water runoff.

Trees prevent soil erosion.

Trees help buffer noise pollution.

Trees cool our homes, streets, and cities.

Trees can save you money on energy costs.

Trees are beautiful.

Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?​

Answers

Higher pleasure is a pleasure that would be chose by a greater number in the population.

What is higher pleasure?

The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.

I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.

What is higher pleasure: https://brainly.com/question/22406307

Other Questions
I need help, this is related to poetry What is the Petrarchan sonnet divided into?A. three partsB. four stanzasC. an octave and a sestetD. couplets and quatrains An executive hires 3 office workers from 5 applicants. How many ways can the selection be made ? How can two cells of a complex multicellular organism have the same genome, but markedly different structures and functions PLEASE HELP!!!!!Deep-sea divers use a breathing mixture of helium, oxygen, and carbon dioxide. What is the partial pressure of oxygen if the total pressure of the mixture is 760 mm Hg, the pressure exerted by the helium is 609 mm Hg, and the pressure exerted by the carbon dioxide is 1 mm Hg?A 760 mm HgB 500 mm HgC 150 mm HgD 609 mm Hg HELP ASAP I'm putting a lot of points and I'll give you brainiest Which function has a constant additive rate of change of 1/4? A coordinate plane with a straight line with a negative slope. The line passes through (negative 2, 2) and (2, 1).A coordinate plane with a curved line passing through (negative 1, 2), (0, negative 1), the minimum (2, negative 2), and (4, negative 1).A two column table with five rows. The first column, x, has the entries, 20, 21, 22, 23. The second column, y, has the entries negative 1, negative 1.5, negative 2, negative 2.5.A two column table with five rows. The first column, x, has the entries, negative 12, negative 11, negative 10, negative 9. The second column, y, has the entries, 7, 11, 14, 17. For the function f(x)=x^212x+32, find x when f(x)=4. Which of this following value on the absolute scale of temperature is to the point A right triangle has legs of length 121 cm and 134 cm.What is the length of the hypotenuse of the right triangle?Enter the answer, rounded to the nearest tenth, in the box.cm HELPPP PLSSSSSSSSSThere are 15 players on the basketball team. The cost of traveling to a tournamentis $650 plus $75 per player. If the team has a $1500 budget for this tournament,how many of the 15 players can go? Write an inequality and solve the problem. discuss the effects imposed/caused by climate change on the environment humans and economy of South Africa Evaluate the expression for x = 3, y = 1/3 , and z = 5.12x 3y / 4x z Both nobles and peasants had duties to fulfill Divide.1.15610 6Enter your answer in the box. I dont get this I need help Which of the following inequalities can be used to represent a number x that is greater than -5 and less than 3? This artistic representation of metalworking, which show the creativity and versatility that can be achieved with metal, is entitled, _____________. she wasAthena challenged Arachne to a spinning and weaving contestenraged that Arachne dared to compare herself to a goddess.A. howeverB. althoughC. becauseD. therefore What impact does Creativity do to most people or to you? where did the name tank come from 1839 Schneiden and Schwann propose a cell theory.