S-waves can move through both solid and liquid substrate.
A. True
B. False
Answer:
B. False
Explanation:
Why can't S-waves move through both solid and liquid substrate? The reason why is that only solids can be traversed by S-waves. This is due to the fact that liquids and gases do not resist altering shape.
What is the mRNA that would be transcribed from this strand of DNA?
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
If the side of a cubical cell doubled, what would the cell then require? Select all the correct answers.
A. eight times more nutrients
B. to excrete eight times more waste
C. four times more nutrients
D. to excrete four times more waste
Given what we know, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.
Why would the cell require more nutrients?This has to do with the ratio between surface area and volume. Since volume is squared when calculating it, the volume of a cell increases much more rapidly than that of its surface area. So a cell that doubles in size would quadruple in volume, needed four times as many nutrients to maintain its internal processes.
Therefore, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.
To learn more about cells visit:
https://brainly.com/question/5763151?referrer=searchResults
- Explain the differences in growth between animals and plants
Answer:
The differences are given below
Explanation:
Plants differ from animals in their manner of growth. As young animals mature, all parts of their bodies grow until they reach a genetically determined size for each species. Plant growth, on the other hand, continues throughout the life span of the plant and is restricted to certain meristematic tissue regions only.
Which of these was a fundamental cause of ww1
Answer:
C) the growth of nationalism in Europe
Explanation:
took test
pls mark brianilest
<3
Which statement best describes the relationship between cellular respiration and photosynthesis?
a.Cellular respiration and photosynthesis have the same products but use different reactants.
b.Cellular respiration and photosynthesis are the same processes; one occurs in animal cells and the other in plant cells.
c.Cellular respiration produces oxygen, which is the reactant required for photosynthesis.
d.Cellular respiration produces carbon dioxide, which is the reactant required for photosynthesis.
25 POINTS
Check all the continents below that experienced an increase in average annual temperature.
Europe
Africa
North America
South America
Antartica
Australia
Asia
Answer:
Europe, North America and Asian:
An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.
Answer:
B
Explanation:
there are complex feeding mechanisms at work to protect the other species in the food web
Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?
Higher pleasure is a pleasure that would be chose by a greater number in the population.
What is higher pleasure?The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.
I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.
What is higher pleasure: https://brainly.com/question/22406307
(11)
19) As water is heated by the sun, it becomes less
dense and rises. What causes the decrease in the
density of warming water?
A. The water particles move faster, causing the
water to expand.
B. The water particles move slower, causing the
water to expand.
C. The water particles move faster, causing the
water to contract.
D. The water particles move slower, causing the
water to contract,
bluod
w
Is Turritopsis dohrnii capable of bioluminescence?
A. Yes Turritopsis dohrnii is capable of bioluminescence.
B. No Turritopsis dohrnii is not capable of bioluminescence.
Answer:
A. Yes Turritopsis dohrnii is capable of bioluminescence.
Explanation:
Which international organization had the goal of ending smallpox?
A.World Health Organization
B. Organization of American States
C.World Trade Organization
D. North Atlantic Treaty Organization
E.US Olympic Committee
Answer: World Health Organization.
Explanation:
A crossover in meiosis is an exchange of genetic material between
A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes.
2.
A tetrad is made up of
A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids.
3.
Which of the following statements about crossing over is TRUE?
A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above
4.
Crossing-over occurs during prophase I of meiosis.
A) True
B) False
5.
Crossing-over allows the reassortment of linked genes.
A) True
B) False
A crossover in meiosis is an exchange of genetic material between
A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes. ✓
During meiosis, the two chromosomes in each parent,swipe their place resulting in a hybrid new genetic material2.A tetrad is made up of
A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids. ✓
Tetrad is a group of four chromatids formed in pachytene stage of meiosis3. Which of the following statements about crossing over is TRUE?
A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above ✓
The process of crossing over takes place between homologous chromosomes to increase genetic diversity4.Crossing-over occurs during prophase I of meiosis.
A) True ✓
B) False
crossing over helps in genetic variation and occurrs between prophase 1 & metaphase 15. Crossing-over allows the reassortment of linked genes.
A) True ✓
B) False
Crossing over helps in the reassortment of non-sister chromatids of non-homologous chromosomesCrossing over may be defined as the process through which the exchange of genetic material between homologous chromosomes takes place that results in the mixture of parental characteristics in the offspring.
According to the context of this question, the process of crossing over takes place during the Pachytene stage of meiosis which significantly involves the reassortment of linked genes.
Therefore, each of the given questions is well answered above.
To learn more about Crossing over, refer to the link:
https://brainly.com/question/927405
#SPJ2
8. In
In the
rock Cyce, igneous, sedimentary
and metamorphic
become magma again.
How does this happen?
Earth science
Answer:
Over millenia, these rocks get pushed back into the Earth's mantle, and get pushed into a volcano heating it up and turning it into magma.
Explanation:
Magma is molten rock, meaning existing rocks must be getting melted, the way the melting happens is by the rocks getting pushed into the ground by landforms and penetrating the mantle, this is how the cycle starts all over again.
A student is designing a device for humans to communicate through detectable light. Which waves should the student use from the electromagnetic spectrum? A X-ray waves B visible waves C infrared waves D ultraviolet waves
A.it should be a x-ray waves
True or False? A forest of conifers holds more living matter than tropical rainforests.
A. True
B. False
Answer:
true
Explanation:
The statement "a forest of conifers holds more living matter than tropical rainforests" is definitely true.
How do coniferous forests differ from tropical rainforests?Tropical Rainforests undergrowth is evenly distributed. Not much plant growth as very little sunlight passes through the canopy and reaches the forest floor, But coniferous has little undergrowth due to the low amount of sunlight received and the low soil nutrient.
The tropical rainforests have higher and large heights of trees and other vegetation. Due to this, other living matter must definitely be inhibited due to the absence of sunlight.
While in conifers, the height of trees and other vegetation is shortly limited, due to which other living matter also receive a high amount o sunlight. As a result of this, they grow and reproduce successfully.
To learn more about Tropical rainforests, refer to the link:
https://brainly.com/question/1146251
#SPJ2
The____focuses the light
lens
pupil
retina
6-10 Importance of planting
Answer:
Importance of Planting
Explanation:
Trees increase property values.
Trees clean the air.
Trees slow water runoff.
Trees prevent soil erosion.
Trees help buffer noise pollution.
Trees cool our homes, streets, and cities.
Trees can save you money on energy costs.
Trees are beautiful.
Which of the following is the strongest conclusion to an informative essay about Sherlock Holmes's strongest character traits as a detective?
A. In conclusion, Sherlock Holmes's drive to find answers and his observation skills led to his success as a detective. Plenty of readers admired this detective and went on to become detectives, too. While none were as famous as Holmes, many joined him in saying, "It's elementary, Watson!"
B. In summary, Sherlock Holmes was determined to find answers, no matter what.
He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.
C. To conclude, Sherlock Holmes became a detective so that he could use his character traits for good. He searched for answers in The Mystery of the Lost Gem, even when Mrs. Blakely doubted him. Sherlock's drive to find answers was rewarded at last.
D. To summarize, Sherlock Holmes's character traits led to his success as a detective. Many readers admired this detective and tried to imitate him, even going so far as to say, "It's elementary, Watson!"
The strongest conclusion to this informative essay about Sherlock Holmes is: B. In summary, Sherlock Holmes was determined to find answers, no matter what. He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.
What is an informative essay?An informative essay can be defined as a literary work that presents factual information about an event, people, places or things.
This ultimately implies that, the main purpose of an informative essay is to provide sufficient information and explanation about an event, object, person (individual), places, or phenomenon to the readers (audience).
In this context, Sherlock Holmes's strongest character traits such as his five senses, as a detective should be highlighted or presented to the readers (audience).
Read more on informative essay here: https://brainly.com/question/19949636
If a cell has 26 chromosomes before meiosis begins, how many tetrads will it contain after Anaphase I?
Answer:
After Anaphase I, the cell will contain 13 tetrads, since each of the 26 chromosomes has been divided into two parts, representing a total of 26/2 = 13 tetrads.
Label what each letter means (photosynthesis)
Answer:
A- sunlight B-Oxygen C-carbon dioxide emission
Explanation:
Compare how energy is used worldwide with how it is used in the United States.
Answer:
the U.S comsumes almost 15% of the worlds energy
Explanation:
yes
Define what it means when we say a molecule is Hydrophobic
Answer:
Hydrophobic is a property of a substance that repels water. It means lacking affinity for water, and tending to repel or not to absorb water. Hydrophobic molecules tend to be non-polar molecules and group together.
Explanation:
Hydrophobic molecules tend to be non-polar molecules and group together, thus, prefer other neutral molecules and nonpolar solvents. Oils and fats are hydrophobic.
Which environmental change would most likely result in bullfrog offspring that are able to store more water than bullfrogs in previous generations?
A.
a dry season that lasts for a month
B.
flooding that turns the valley into a lake
C.
a drought that lasts for a very long time
D.
a rainy season that lasts for a month
Answer:
C.
a drought that lasts for a very long time
Which one of the following is the softest?
(A) Aluminium
(B) Iron
(C) Lithium
(D) Sodium
Answer:
Sodium
Explanation:
Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .If allowed to grow naturally, minerals will form:
conglomerates
layers
rocks
crystals
Answer:
D.) crystals
Explanation:
have a good day :)
Answer:
crystals
Reason :
Crystals occur in nature when particles cluster to solidify as a liquid cools down and solidify. This is referred to as crystallization, and it can occur when molten solidifies or when liquid evaporates from an organic combination.
WILL MARK THE BRAINLIEST!!!
Name the three major Subphyla and an example of an animal in each
Answer:
The three major Subphyla are:
Explanation:
Vertebrata (fish, amphibians, reptiles, birds, and mammals)
Tunicata or Urochordata (sea squirts, salps)
Cephalochordata (which includes lancelets). There are also extinct taxa such as the Vetulicolia.
hope this helped :)
Make a claim for reasons
a
not to build homes and roads on a wetland.
Answer:
floods
Explanation:
if your in the wetlands then it probably floods pretty bad so you don't want to build there
Using the 10% rule when studying trophic pyramids, if the autotrophs produce 100 joules of energy, how much energy is passed on to the herbivores?
A: 15 Jouls
B: 10 Jouls
C: 0.1 Jouls
The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by
the action of
(A) decomposers
(B) producers
(C) primary consumers
(D) secondary consumers
Answer:
A
Explanation: Just what decomposers do, break down organic and sometimes inorganic material
The organic and inorganic materials in all of the organisms in the diagram will eventually return to the environment by the action of decomposers. Thus, the correct option is A.
What is the Environment?The Environment may be characterized as anything which is present in the surrounding of any living organism. The term "Environment" was given by Carlyle.
Decomposers are organisms that can significantly have the capability to break down dead, decaying organisms that remarkably contain organic as well as inorganic material in their body composition.
Such types of organisms convert dead and decaying matter into humus. They are also known as detrivores.
Producers are those that can synthesize their own food with the help of sunlight through the process of photosynthesis. While primary consumers are those that directly deed on the producers. They are also known as herbivores.
Therefore, decomposers are living organisms that perform the action of converting all organic and inorganic materials of the living organisms into the environment.
To learn more about Decomposers, refer to the link:
https://brainly.com/question/380333
#SPJ6