Hi! Kindly give me the formula for finding the percentage of profit.


Profit and selling price are given. Thank you in advance!​

Answers

Answer 1

When the selling price and the cost price of a product is given, the profit can be calculated using the formula, Profit = Selling Price - Cost Price. After this, the profit percentage formula that is used is, Profit percentage = (Profit/Cost Price) × 100.

Answer 2

Step-by-step explanation:

Given:

Profit P and selling price Sp

Find cost price Cp first:

Cp = Sp - P

To find the percentage profit divide the profit by the cost price and multiply by 100%:

P% = P/(Sp - P)*100%

Related Questions

here is the next question jj

Answers

Answer:

3.7 and east.

Step-by-step explanation:

Answer:

3.7 and east

Hope this helps! Good luck!! :)

What is -7w-4-5w+13 simplified?

Answers

-12W+9
It’s right I am an algebra 1 teacher

While Jayden was at school, his house lost electrical power. By
the time the electrical power came back on the temperature inside the
house was 86°F. The air conditioner immediately started to cool the
house.Let f(x) represent the temperature, in degrees Fahrenheit, of
Jayden's house x minutes after the air conditioner started to cool the
house.What is the meaning of the statement f(25)=78?

Answers

Answer:

after 25 minutes the temperature was at 78 degrees

Step-by-step explanation:

PLEASE NO LINKS AND NO NEGATIVITY

Answers

Answer:

-21z-35t+21g

Step-by-step explanation:

Use the distributive property of multiplication to distribute -7 to 3, 5, and -3. -7*3 is -21, so we are left with -21z. -7*5 is -35, so we are left with -35t. Finally, -7*-3 is 21, so we are left with +21g

Find the roots 5x^2+16=7x^2/3

Answers

Answer: I Got No solution for this problem

Step-by-step explanation:

Graph each side of the equation. The solution is the x-value of the point of intersection.

No solution

If one of the roots of the equation x² – 4x + k = 0 exceeds the other by 2, then find the roots and determine the value of k.

Answers

Step-by-step explanation:

the solutions for a quadratic equation is

x = (-b ± sqrt(b² - 4ac))/(2a)

in our case

a = 1

b = -4

c = k

x = (4 ± sqrt(16 - 4k))/2 = 2 ± sqrt(4 - k)

x1 = 2 + sqrt(4 - k)

x2 = 2 - sqrt (4 - k)

x1 = 2 + x2

2 + sqrt(4 - k) = 2 + 2 - sqrt(4 - k)

2×sqrt(4 - k) = 2

sqrt(4 - k) = 1

4 - k = 1

k = 4 - 1 = 3

x1 = 3

x2 = 1

Answer:

The roots are 1 and 3.

k = 3.

Step- by-step explanation:

We use the facts that if α and β are the roots of ax^2 + bx + c = o then α+ β = -b/a and  α β = c/a.

The roots are written as  α and α+2, then:

α + α + 2 = -(-4)

2α + 2 = 4

α + 1 = 2

α = 1

also

α (α + 2) = k

Substituting for α:

1(1 + 2) = k

k = 3.

The roots are 1 and 1 + 2 = 3.

Find the value of x.

Answers

Answer:

Value of [tex]x=-12[/tex]

Step-by-step explanation:

The given triangle is isosceles

Here

[tex]m\angle2+m\angle2+36^0=180^0\\\\2m\angle2=144^0\\\\m\angle2=72^0\\\\x+84=72\\\\x=72-84\\\\=-12[/tex]

[tex]m∠2+m∠2+36⁰= 180°[/tex]

[tex]2m∠2 = 144°[/tex]

[tex]m∠2 = 72⁰[/tex]

[tex]x +84 = 72[/tex]

[tex]x = 72 - 84[/tex]

[tex]x= -12[/tex]

Michele
wants to save $150 for a trip to the Sox Flags amusement park. she saves $12 each week, how
weeks will it take her to save enough money for the tri?

Answers

Answer:

Twelve and a half weeks

Step-by-step explanation:

Answer:

12 and a half weeks

Step-by-step explanation:

150/12=12 and a half since she takes 7 days to earn 12 dollars, 12x12 and 1/2=150

Write the equation of a line that is perpendicular y=-2 And that passes through the point (8,-4)

Answers

Answer:

y=1/2-8

Step-by-step explanation:

slope is 1/2

-4-y=1/2(8-x)

-4-y=4-1/2

-y=-1/2+8

y=1/2-8

Gabriel purchases a rug priced at $475. With sales tax, the total comes out to $513. What is the sales tax percentage?

Answers

Answer:

The tax is 8%

Step-by-step explanation:

Take the final price and subtract the original price

513-475 = 38

Divide by the original price

38/475 =.08

Change to percent form

8%

The tax is 8%

The tax price is 8%

513 - 475 = 38

38/475 = 0.08

To check your work.

475 x 0.08 = 38

475 + 38 = 513

Meaning the answer is 8%

A sector of a circle makes a 127° angle at its centre. If the arc of the sector has length 36 mm, find
the perimeter of the sector.

Answers

Answer:

Approximately [tex]68.5\; \rm mm[/tex].

Step-by-step explanation:

Convert the angle of this sector to radians:

[tex]\begin{aligned}\theta &= 127^{\circ} \\ &= 127^{\circ} \times \frac{2\pi}{360^{\circ}} \\ &\approx 2.22\end{aligned}[/tex].

The formula [tex]s = r\, \theta[/tex] relates the arc length [tex]s[/tex] of a sector of angle [tex]\theta[/tex] (in radians) to the radius [tex]r[/tex] of this sector.

In this question, it is given that the arc length of this sector is [tex]s = 36\; \rm mm[/tex]. It was found that [tex]\theta = 2.22[/tex] radians. Rearrange the equation [tex]s = r\, \theta[/tex] to find the radius [tex]r[/tex] of this sector:

[tex]\begin{aligned} r&= \frac{s}{\theta} \\ &\approx \frac{36\; \rm mm}{2.22} \\ &\approx 16.2\; \rm mm\end{aligned}[/tex].

The perimeter of this sector would be:

[tex]\begin{aligned}& 2\, r + s \\ =\; & 2 \times 16.2\; {\rm mm} + 36\; {\rm mm} \\ =\; & 68.5\; \rm mm\end{aligned}[/tex].

HELP HURRY PLS

What is the equation of this line?
y =2/3x
y=3/2x
y= -2/3x
y= -3/2x

Answers

Answer:

y = 2/3x

Step-by-step explanation:

an auto dealership got a new shipment of 33 cars. Of these, two are red , 6-cylinder 4 door sedans; one is a red 4-door, but not a 6-cylinder sedan. There are four 6-cylinder 4-door sedans that are not red, and three red 6-cylinder sedans that are not 4-door sedans. Altogether, 19 of the 33 cars are 6-cylinder sedans and 12 of the 33 are 4-door sedans. How many of the 33 cars are red but neither 6-cylinder nor 4-door sedans?

Answers

Answer:

2

Step-by-step explanation:

If you take 19 6-cylinder sedans and add 12 4-door sedans you get 31, therefore making 2 red and neither 6-cylinder nor 4-door sedans. Hope this helps!

What is 5 1/4 ➗ -2 1/2 equal to?

Answers

Answer:

-2.1

Step-by-step explanation:

Answer:

Hi, I hope i'll help you.

Step-by-step explanation:

The answer is 2.1, hope it helps!

Which of these is always true?

A. Two lines that are the always same distance apart are perpendicular.

B. Two lines that are always the same distance apart are parallel.

C. Two lines that share common end point are always perpendicular.

D. Two lines that share common end point are always parallel.

Answers

Answer:

B

Step-by-step explanation:

(Meeting character limit)

en un maratòn participan corredores de todos los continentes 5/6 de los corredores son europeos se sabe que los americanos son la dècime parte de los europeos y que los africanos son la quinta parte de los americanos el resto de los participantes son mitad asiaticos y mitad de Oceanìa

Answers

Usando proporciones, se encuentra que 400 africanos han participado.

En total, hay x participantes.

[tex]\frac{5}{6}[/tex] de los corredores son europeos, o sea:

[tex]E = \frac{5x}{6}[/tex]

Los americanos son la dècime parte de los europeos, o sea:

[tex]Am = \frac{1}{10}E = \frac{5x}{60} = \frac{x}{12}[/tex]

Los africanos son la quinta parte de los americanos, o sea:

[tex]Afr = \frac{1}{5}Am = \frac{x}{60}[/tex]

En la carrera han inscritos 24 000 participantes, o sea, [tex]x = 24000[/tex]. Por eso, la cantidad de africanos es:

[tex]Afr = \frac{x}{60} = \frac{24000}{60} = 400[/tex]

Para obtener más información sobre las proporciones, puedes visitar a https://brainly.com/question/24615636

Answer: Quiere preguntar alguna perosnas que sabe los importante preguntas.

Step-by-step explanation:

Olivia and her friends went to the movies with $45 to spend. She bought popcorn for $6.75 and paid
$9.25 for each movie ticket for her and her friends. What was the greatest number of movie tickets Olivia
could have bought?
A. 3
B. 4
C. 5
D. 6

Answers

the answer is 5 tickets

Answer:

5 tickets

Step-by-step explanation:

45 - 6.75 = 37.35

37.35 ÷ 4 = 9.3375

So, she still has enougg for one more ticket. 4 + 1 is 5. 5 tickets

There are 81 calories in a 0.75 cup serving of chicken noodle soup. How many calories are in a 2 cup serving?

Answers

Answer:

162

Step-by-step explanation:

There are 81 calories in a 0.75 cup serving of chicken noodle soup. How many calories are in a 2 cup serving?

0.75*2=2 cups

81*2=162

Answer:

x = 216

Step-by-step explanation:

[tex]\frac{81}{0.75}[/tex] = [tex]\frac{?}{2}[/tex]

I hope this helps!!

HELP IM REALLY BEHIND ON MY MATH THE RIGHT ANSWER WILL GET BRAINLIEST

Answers

Answer:

N=3

Step-by-step explanation:

use cross multiplication to find 28N=84 and then divide both sides by 28 to get N=3

Answer:

N = 3

Step-by-step explanation:

Given Δ ABC is similar to Δ DEF , then the ratios of corresponding sides are in proportion, that is

[tex]\frac{AB}{DE}[/tex] = [tex]\frac{BC}{EF}[/tex] , substitute values

[tex]\frac{21}{N}[/tex] = [tex]\frac{28}{4}[/tex] = 7 ( multiply both sides by N to clear the fraction )

21 = 7N ( divide both sides by 7 )

3 = N

please show work

10. If the area of a parallelogram is 690.84 m2 and the height is 20.2 m, what is the length of the base?

Answers

Answer:

34.2 m

Step-by-step explanation:

We know that

Area of parallelogram = Base × Height

690.84 = B × 20.2

690.84/20.2 = B

34.2 = B

Hence,

Base of parallelogram is 34.2 m

[tex]\huge{\purple{\underline{\underline{\bf{\pink{ANSWER:-}}}}}}[/tex]

Here we've been given:

Area of parallelogram (A) = 690.84 m²

Height (H) = 20.2 m

Length of base (B) = ?

[tex]:\longrightarrow\tt{Area \: of \: parallelogram = Base \times Height} \\ \\ :\longrightarrow\tt{690.84 = B \times 20.2} \\ \\ :\longrightarrow\tt{ \frac{690.84}{20.2} = B} \\ \\ :\longrightarrow\tt{34.2 = B} \\ \\ :\longrightarrow\tt{B = 34.2 \: m}[/tex]

The length of base is 34.2m.

H(x)=(x+5)^2 if we solve h(x)=36
One of the possible values of x is 1
What is the other possible value of x?

Answers

Answer:

x =  - 11

Step-by-step explanation:

Solving

(x + 5)² = 36 ( take square root of both sides )

x + 5 = ± [tex]\sqrt{36}[/tex] = ± 6 ( subtract 5 from both sides )

x = - 5 ± 6

Then

x = - 5 + 6 = 1

x = - 5 - 6 = - 11

The other solution is x = - 11

Question 17 of 25
Solve |3x + 3| = 21.
A. C= –6 and x = 8
B. X = 6 and x = -8
C. X= -6 and x=-8
D. X= 6 and x = -
-6

Answers

Answer:

D. 1.25. 30 31 - 35. Convert the answer into a mixed number by dividing ... 8.7 6 5. 4.235. Subtract the two numbers. B. 4.235. 14) V81. 8) 0.2 * 0.3 * 0.4.

Step-by-step explanation:

HELP ME PLEASEEEE
6(p+2.25)=15 9/10 DUE RIGHT NOWWWW

Answers

Answer:

p=2/5

p=0.4

Step-by-step explanation:

Answer:

p=2/5

Step-by-step explanation:

6p+13.5=159/10

solve for A and line AB

Answers

Answer:

a = 22

AB = 50

Step-by-step explanation:

[tex]a-5=17[/tex]

[tex]a=17+5[/tex]

[tex]a=22[/tex]

Line AB=2a+6

[tex]2(22)+6=44+6=50[/tex]

[tex]AB=50[/tex]

Hope this helps

3/5 x (1/5 + 4/5) What is the answer

Answers

Answer:

The answer is 0.6

Step-by-step explanation:

Let’s break this question down.

Using BIDMAS or BODMAS, whatever you are taught, we must work out everything inside the brackets first.

So 1/5 + 4/5 = 5/5 = 1

Now we can do 3/5 x 1 = 3/5.

Therefore, the answer is 3/5.

Hope this helps :)

What is the value of the expression [−18+(−22)]−43+12?

Answers

Answer:

-71

Step-by-step explanation:

Answer:

-71

Step-by-step explanation:

[-18+(-22)]-43+12

=(-18+22)-43+12

=-40-43+12

=-83+12

=-71

Mr Page uses oil to heat his home.
At the beginning of November there were 1000 litres of oil in his oil tank.
Mr Page bought enough oil to fill the tank completely.
He paid 50p per litre for this oil.
He paid a total amount of £750
At the end of February Mr Page had 600 litres of oil in the tank.
He bought enough oil to fill the tank completely.
The cost of oil had increased by 4%.
Work out the total amount Mr Page paid for the oil he bought in February.

Answers

The total amount Mr Page paid for the oil he bought in February was $21,580.

Since Mr Page uses oil to heat his home, and at the beginning of November there were 1000 liters of oil in his oil tank, and Mr Page bought enough oil to fill the tank completely, and he has paid $50 per liter for this oil, and he has paid a total amount of $750, while at the end of February Mr Page had 600 liters of oil in the tank, and he has bought enough oil to fill the tank completely, and the cost of oil had increased by 4%, to determine the total amount Mr Page paid for the oil he bought in February, the following calculation must be performed:

1000 + (750 / 50) = X1000 + 15 = X1015 = X1015 - 600 = 415415 x (50 x 1.04) = X415 x 52 = X21,580 = X

Therefore, the total amount Mr Page paid for the oil he bought in February was $21,580.

Learn more about maths in https://brainly.com/question/16933803

A rental car company charges $33.73 per day to rent a car and $0.06 for every mile
driven. Elizabeth wants to rent a car, knowing that:
She plans to drive 450 miles.
• She has at most $430 to spend.

Which inequality can be used to determine x, the maximum number of days
Elizabeth can afford to rent for while staying within her budget?

Answers

Answer:

430 > 33.73x + 27      ---->         x < 11

Step-by-step explanation:

The inequality describes the total amount that can be spent for a whole number of days. To solve for the number of days, solve for x (x<11.95). Because she can't rent for only a part of a day, and because she can't spend more than $430, the inequality becomes x<11.

Answer:

Step-by-step explanation:

33.73x + 27 <= 430

0.06 is for every mile. She plans to drive 450 miles. So 0.06 times 450. Which is 27.

Then your have the 33.73 for each day for the rent of the car. We don't know how many days so we'll just put x.

What is the equation of the line that is perpendicular to line m and passes through the point (3, 2)?

Answers

Answer:

y = [tex]\frac{2}{5}[/tex] x + [tex]\frac{4}{5}[/tex]

Step-by-step explanation:

Calculate the slope of line m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (- 2, 2) and (x₂, y₂ ) = (0, - 3) ← 2 points on the line

m = [tex]\frac{-3-2}{0-(-2)}[/tex] = [tex]\frac{-5}{0+2}[/tex] = - [tex]\frac{5}{2}[/tex]

Given a line with slope m then the slope of a line perpendicular to it is

[tex]m_{perpendicular}[/tex] = - [tex]\frac{1}{m}[/tex] = - [tex]\frac{1}{-\frac{5}{2} }[/tex] = [tex]\frac{2}{5}[/tex] , then

y = [tex]\frac{2}{5}[/tex] x + c ← is the partial equation in slope- intercept form

To find c substitute (3, 2 ) into the partial equation

2 = [tex]\frac{6}{5}[/tex] + c ⇒ c = 2 - [tex]\frac{6}{5}[/tex] = [tex]\frac{4}{5}[/tex]

y = [tex]\frac{2}{5}[/tex] x + [tex]\frac{4}{5}[/tex] ← equation of perpendicular line

Which of the following is an equation of a line perpendicular to the equation
y - 3x +1?
O A = - 3x + 5
B. y --3x+5
O C. y -3x5
O D. y = x+5

Answers

Answer:

There is something wrong in the answer options.  Please check the equations and formatting.  

Step-by-step explanation:

Assuming the referenced equation is y = 3x + 1 (and not y - 3x + 1), we can say the following.

This is written in the form of y=mx+b, where m is the slope and b the y-intercept (the value of y when x=0).

The slope, as I've written it, is 3.  Parallel lines will have the same slope (but a different b).  Perpendicular lines will have a slope that is the negative inverse of the slope of the reference line.  In this case, it would have a slope of -(1/3).

None of the answer options come close to this.  So something is wrong in the question, unless "NONE" is an option.

Other Questions
Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. who were dev and ashamvav At a hospital, 56 percent of the babies born are not girls. Of the baby girls born, 12 percent are premature. What is the probability of a premature baby girl being born at this hospital? round to the nearest percent. Why did Marshall describe the economy in Europe over the past 10 years as "highlyabnormal"? which organelle modifies sorts and packages proteins I need some essay ideas for: "Describe the biggest challenge youve faced and overcome as a student OR Describe a time when you failed and persevered through the situation?"What can I write about? DNA contains all the traits that we inherit from our parents.True or false