HELP. HELP.

True or False: If two organisms are located near one another on a phylogenetic tree they share a recent common ancestor.

Answers

Answer 1
Im pretty sure it’s true

Related Questions

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

Meiosis and Mutations are both sources of/for:
O Genetic Drift
O Polyploidy
O Mutations
Genetic Diversity

Answers

Answer:

genetic drift

please mark as brainlest

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

Petra finds a discolored stain on the carpet at a suspected crime scene. What two presumptive tests might she use to determine if the stain is blood? First, Petra sprays the discolored area with , which returns a glowing blue color. However, she knows that this chemical might also turn blue with other substances that contain iron. Subsequently, she uses , which turns pink, indicating the presence of hemoglobin.

Answers

Answer:

First, Petra sprays the discolored area with  

Fluorescein

, which returns a glowing blue color. However, she knows that this chemical might also turn blue with other substances that contain iron. Subsequently, she uses  

Phenolphthalein

, which turns pink, indicating the presence of hemoglobin.

Answer:

a. luminol b. phenolphthalein

Explanation:

looked it up, luminol turns green and the other one turns pink

What type of graph is used for a PH test

Answers

Explain why a line graph is used for the pH data. Line graphs are utilized when data is continuous. It’s either a line graph or bar graph but usually line graph

Many closely related species of ducks have different courtship dances that are performed to solidify a pair-bond. If you were to cross individuals from each of these species what would you expect to see in the hybrid offspring if behaviors related to pair-bond formation were completely due to genetics?

Answers

Answer:

I would expect to see a new phenotype in which the new duck hybrid species would express a new mixed courtship dance with the behaviors of both parentals.  

Explanation:

The cross between both parentals, each from different species, might produce a new phenotype that exhibits both parental dances. The new dance might be considered a hybrid of the parental dances.

Genetically speaking, we can think that there is a gene codifying for the courtship behavior in one species and another gene expressing a different courtship behavior in the other species. This cross´ product would be a hybrid species that exhibits a part of both parentals´ behaviors.

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

Please help ASAP!!!
In the formation of pollen grains, the nucleus in the pollen will divide by mitosis to form two nuclei. Justify.​

Answers

Answer:

The other two, the generative nuclei, can be thought of as non motile sperm cells. After reaching an ovule and breaking out of the pollen tube tip, one generative nucleus unites with the egg cell to form a diploid zygote.

Explanation:

This means that;

The fertilized egg with two complete sets of chromosomes, one from each parent. The zygote undergoes a limited number of divisions and gives rise to an embryo.

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

I need help with this

Answers

Answer:

what is the name of this website

or the book?

Do the benefits seem to outweigh the risks of genetically modifying about the glittering gold seahorse Explain your rationale.

plz help ​

Answers

Answer:

yes it does

Explanation:

15. Cells found in plants and animals have similarities but can differ in function. Consider the following two organisms: a corn plant cell (Zea mays) and a camel cell (Bactrianus ferus). What is the best explanation for the difference in the cellular vacuole size between these two biotic organisms?

A. The corn cells' have a small vacuole size because it does not need long term water and
electrolyte storage.

B. The camel cells' have a small vacuole size because it does not need long term water and electrolyte storage.

C. The camel cells' have a small vacuole size because it is not in contact with toxins that need to be removed from the cell.

D. The corn cells' have a large vacuole size because it is in contact with many toxins in the soil which need to be removed from the cell.

Answers

The best explanation for the difference in the cellular vacuole size is option d. The corn cells' have a large vacuole size.

Explanation to the difference in the cellular vacuole size:

When there is the difference in the vacuole size that lies between the two biotic organism so it is due to the corn cells that contain high vacuole since they are in contact with various toxins in the soil that need to be eliminated from the cell.

hence, the correct option is d.

And, the rest of the options are wrong.

Learn more about cell here: https://brainly.com/question/14568392

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

Consider the following chemical reaction: Hb + O2 → HbO2 When this reaction is going from right to left, what process is occurring?

O a. oxygen unloading

O b. cellular respiration

O c. pulmonary ventilation

O d.oxygen loading

Answers

Answer: A, Oxygen Unloading

What are Tectonic Plates made of and what do they do?

Answers

Answer:

They move

Explanation:

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere.Plate tectonics move because they are carried along by convection currents in the upper mantle of the planet (the mantle is a slowly flowing layer of rock just below Earth's crust). Hot rock just below the surface rises and when it cools and gets heavy, it sinks again.

Explanation:

The average number of individuals of the same species per unit of area or volume at a given time is the
population's
O carrying capacity,
O birth rate.
O size.
Odensity.
O distribution.
Next >

Answers

Huhhhhhhhhhhhhhhhhhhhhhhhh

P S Q R The biological levels of organization range from a single organelle all the way up to the biosphere in a highly structured hierarchy. Multicellular organisms are organized from the simplest to most complex: cells, tissues, organs, organ systems, organisms. Evaluate the model above. Select ALL of the statements that accurately depict the examples shown in the model. A) R shows an animal cell. B) O shows types of tissue. P shows organs in the endocrine system. D) P shows an organ system, the digestive system. E) S shows an organ system, the digestive system.​

Answers

Answer: the red thing pretend is blood and blue thing is water you first ta

Explanation:

Answer:

A) R → Q → P → S

Explanation:

I just took the test on USA Test Prep

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

Lungs, Trachea, Diaphragm, Nose: Which organ system do these belong to?
Circulatory
Excretory
Digestive
Musculoskeletal
Respiratory

Answers

Answer:

Respiratory

Explanation:

they all come together and help with breathing and oxygen :)

Answer: respiratory system

Explanation:

What is the range for the following set of measurements?
3.1 mL, 2.7 mL, 4.6 mL, 1.9 mL, 8,7 mL

Answers

The range of the set is 6.8,
because 8.7-1.9=6.8

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

Can you be allergic to peanut oil but not peanuts? Please have a real answer!

Answers

Answer:

it depends

Explanation:

most peanut allergies effect your skin i edviase you check with your doctor

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

Match each idea about evolution to the person or group where it originated from the drop down menu

Answers

Hello. You did not present the ideas about evolution to which the question refers, which makes it impossible for your question to be answered. However, I will try to help you in the best possible way, showing you the main ideas about evolution and the people who originated them.

According to Jean-Baptiste organisms evolve as a way of seeking perfection.

According to the ancient Greeks and Romans, all living things are in a constant process of change. This change causes evolution and when a living being evolves it causes the evolution of another living being, since everyone is connected and related.

According to Darwin, evolution occurs over time and through an ancestor. For him All living beings have a common ancestor, which evolved over time and generated new species. Darvin also believes that any characteristic acquired by evolution could be passed on to the descendants.

According to Malthus, living beings generate a number of descendants disproportionate to the resources necessary for their survival and this causes evolution.

issues of food insecurity in high income countries​

Answers

Not sure i guess people are just insecure to eat in front of people

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC
Other Questions
What is the x-intercept of the equation -3x + 5y = -15 A quantity with an initial value of 400 grows exponentially at a rate such that the quantity doubles every 8 days. What is the value of the quantity after 29 days, to the nearest hundredth? Solar system included all of the following except what? g Let X and Y be two independent standard normal random variables, i.e., each follows the distribution N (0, 1). Now, define two new random variables as Find cov(Z, W) Aidans hourly salary is $11. If Aidan normally works a 40 hour week , then how much is normally earned in a week? A legislative order is issued by the President to set the policies for executive agencies to follow.TRUE OR FALSE During a blind taste test of 8 different sodas, some people were asked to choose a favorite. Each dot represents one person. If the ratio of people choosing B to people choosing H stays the same, he many people will choose H if the number of people who choose B increases to 20 HELP ASAP!!The parent function f(x)= square root of x is translated 2 units right, compressed horizontally by a factor of 21 , and reflected across the x-axis. Jayden is trying to pick out an outfit for the first day of school. He can choose from 2pairs of pants, 3 t-shirts, and 6 pairs of shoes. How many different outfits doesJayden have to choose from? Find the value of x.A. 10B. 17C. 14D. 7 Which sequence is geometric?O 5, 15, 25, 35, ...O 5, 10, 20, 40, ... *O 6, 12, 18, 24, ...O 7, 14, 21, 28, ... Mike and Marianne pulled their resources together to open a coffee place. They each put $20,000 and also took a bank loan of $20,000. Interest rate the bank charges is 8% and estimated tax rate is 30% for their business. If they both want a 12% return on their investment, what is the weighted average cost of capital waht is the answer for this? 3585+525 Help me please thank youuu The base of a triangular prism is a right triangle whose legs are 9 cm and 12 cm. The height of the prism is 33 cm. What is the lateral area of the prism? Complete the explanation on how you can find the answer.You can use the _____ to find the hypotenuse of the base, _____ cm. Then, multiply the perimeter of the base, ______ cm, by the height, _____ cm. The lateral area of the prism is _____ square centimeters. Pleaseeeeeeeeeeee helpppp Why does people not supports the #StopAsianHate movement then #BlackLivesMatter movement? Which sentence in this story from Aesop's Fables portrays the start of the rising action The area of a rectangle Is 52 ft?, and the length of the rectangle is 5 ft less than twice the width. Find the dimensions of the rectangle. What are some conflicts you have seen happening on the playground? How do you think kids could prevent them? Resolve them?