HELP DUE IN 20 MINS!
Brown eye color (B) is dominant to blue color (b). A blue-eyed woman wants to marry a man that will give her a 100% chance of having a brown eyed child. What must the genotype of the prospective husband be to produce only brown eyed babies??

A. bb

B. Bb

C. BB

D. Both Bb and BB

Answers

Answer 1

[tex] \huge\boxed{ \boxed{ \underline \mathcal{Answer}}}[/tex]

The Required genotype of the Man should be BB in order to have only brown eyed offsprings.

Correct option - C. BB

_____________________________

[tex]\mathrm{ ☠ \: TeeNForeveR \: ☠}[/tex]


Related Questions

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.

Answers

-unrestricted prey species growth


Explanation: the less predators the more the prey will reproduce, hence the fact that no one is there to consume them they will increase at a very accelerated speed

A person is observing the oscillations of a wave. If the wave source begins to move away from the person, what will the person notice?

A.
The wavelength will decrease.
B.
The wave appears to have a different amplitude.
C.
The wave appears to change speed.
D.
The wave appears to oscillate at a different rate.

Answers

the wave appears to oscillate at a different rate

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

Is a bird calls warning for prey a physical or behavioral adaptation?
Is an animals body temperature changing a physical or behavioral adaptation?
Is birds flying to high ground when they sense movement a physical or behavioral adaptation?

NO LINKS! NO PDF'S. Please, help ASAP!

Answers

1. the birds call is a behavioral adaptation 2. the animals body temp changing is physical. 3. the birds flying is a behavioral adaptation.

When sea ice melts, there will be a significant amount of sea level rise.
O True
O False

Answers

It will be true, since the ice bergas that fall off can be as big as a 98-164 feet. Form what I have resched

It is False. Because the volume of water they displace as ice is the same as the volume of water they add to the ocean when they melt. So the sea level does not rise when sea ice melts.

pls answer pls please​

Answers

Answer:

1.it's beak is pointed and  slightly curved at pointed

2.it's upper part is brown and lower part is white

3.it's legs is black

Explanation:

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

What is climate change? O A. Lange-scale changes to weather patterns B. Increasing temperatures only C. Natural cycles of cooling and heating D. Decreasing temperatures only ​

Answers

Answer:

C. Natural cycles of cooling and heating is the best option.

Explanation:

C. is the only answer that describes climate, the others describe weather. Climate is natural conditions over a long period of time while weather is over a short period of time.

Please give brainliest.

Please!! I’ll give you lots of points!! PHow do the sensory spines most likely help the cockroach
survive in its environment?
A. They improve the cockroach's vision so it can see
predators sooner.
B. They allow the cockroach to change its body shape
to confuse predators.
C. They reduce the friction along the top of the
cockroach so it can move faster than predators.
D. They allow the cockroach to move through small
spaces where it is unable to use its feet to escape
predators.

Answers

C they reduce friction

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Need help ASAP! Will give brainliest;) NO links please, will report.

Which statement is part of Darwin’s theory of evolution by natural selection?

A). Acquired characteristics that are inherited are the cause of evolution.

B). The organisms that are the fittest are always largest and strongest.

C). The number of offspring is not related to fitness.

D). More offspring are produced than can possibly survive.

Answers

D

More offspring are produced than can possibly survive.

Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk

Answers

Answer:

Honey

Explanation:

Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

True or false Biodiversity has both economical and ecological value within an ecosystem.

Answers

Explanation:

biodiversity has both economic value and ecological value within an ecosystem. ... Human activities can also threaten biodiversity. These activities include habitat destruction, poaching, pollution, and the introduction of exotic species.

HELPPp!!!!!!I’ll mark u brainly

Answers

Answer:

Genotypes - Phenotypes:

TT - Thin

Tt - Thin

tt - Wide upside down

LL - Lopsided

Ll - Lopsided

ll - Parallel

VV - Vertical

Vv - Veritcal

vv - Horizontal

PP - Pink

Pp - Pink

pp - Red

Which of the following would be classified as a renewable resource?
O A barrel of oil that would take 8 million years to form.
A large piece of coal that would take 4 million years to form.
O Solar rays from the Sun that take 8 minutes to reach the Earth.
O Methane gas from the ocean floor that takes 7 thousand years to outgas.

Answers

Answer: Solar rays from the sun that take 8 minutes to reach the earth
The solar rays - as much as the others can be renewed the time that it takes to do so makes them considered fossil fuels

There has a been decrease in the diversity of plants in the grasslands of the Edward's plateau. What has caused this to occur?

Answers

What the person above me said is correct!!! Good luck! Have a good day!

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Which statement correctly shows the flow of energy in a food chain?

A.
Producer→ heterotroph → decomposer

B.
Producer ← consumer ← decomposer

C.
Autotroph← decomposer ← consumer

D.
Autotroph→ decomposer→ heterotroph

Answers

Answer:

Producer→ heterotroph → decomposer

Explanation:

___________________ is a molecule that organisms get from the air or water around them and use to release energy.

Answers

Answer:

Oxygen

Explanation:

In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process. Carbon dioxide and water are products of this reaction

Which of the following are not properties of lipids?

Answers

Answer: Lipid refers to any class of organic compounds that are considered fatty acids. This also includes their derivatives that are soluble in organic solvents, like many natural oils, waxes phospholipids and steroids.

All lipids have similar properties because their molecules are made of the same elements with similar chemical structure that only varies slightly.

Foods like meat, poultry, seafood, beans, peas and eggs are all sources of proteins, while good that contains saturated fat like palm oil, coconut oil, milk, cheese and coffee creamers and butter contain lipids, that may help in storing energy.

Explanation:

There’s no options, add a photo pls

Which part always comes FIRST in the scientific name?

Answers

Answer:

The first part of the scientific name is the genus, and it is always capitalized. (The plural is "genera"). The second part is the species epithet. The entire name is written in italics.

Explanation:

hope this helps

Other Questions
What is the straight-line distance in miles between the capitals of the NorthernTerritory and South Australia?1,000 miles1,600 miles500 miles3,000 miles A decrease in the height of the mercury column usually means the coming of a. Suppose Nicole ran 12 miles in four days. If she ran the same distance d eachday, how many miles did she run in one day? What countries were the Mamluks from?MUTIPLE CHOICE 1. Egypt and Iran2. Iran and Iraq3. Egypt and Syria4. Iran and China yo i need help please ( if u cant see the problem zoom in btw ) but fr i need to pass plz help 6. A positionon the earth's surface best describes which of the five themes ofgeography? How does this diagram facilitate the text?a.helps you to understand the structure and applicationb.reinforce the textc.both of thesed.neither of these Which country or countries can natural gas be found plssssssssssssss help NO LINKS this is du win ten minutes Answer this question to get marked as brainliest!!!! Round your answer to the nearest hundredth A wooden block meauring 40cm x 10cm x 5cm has a mass 850gm . find the density of wood?please answer me. My teacher made up the name big kahuna to make it easier to mesmerize the name but Im not sure what the identity of this Pythagorean is. It relates to trig proofs. The box plot below represents some data set. What percentage of the data values are between 20 and 55? learn.flvs.net/educator/student/examform.cgi?fbean1*bmallory16*mpos=4&spos=0&sit=c1dFd3Hg067rE*4619*0025****1 Question 6(Multiple Choice Worth 2 points) (06.03 MC) How did explorers travel out west? O By canoe and foot O By plane O By steamship and stagecoach By train Question 7(Multiple Choice Worth 2 points) pus Question Question 1 (Answered) 0 Find the area of the shape belowNo links, docs, files, drives etcI will mark the correct answer brainlyestYou earn many points Please help. I will mark brainliest if I can. ASAP I need help. En las siguientes oraciones Cuntos sustantivos hay Sofa lee su libro de cuentos/ mi hermana es enfermera Who's your favorite Rapper?Mine is J.Cole Ben needs to read 450 pages of his book for school. If he has five days to finish, how many pages should he read each day? If we add successive laborers to work a given amount of land on a wheat farm, eventually:____.a. the increases in wheat harvested will get larger and larger. b. average total cost will fall to zero. c. the increases in wheat harvested will rise at a constant rate. d. the increases in wheat harvested will get smaller and smaller.