Describe the steps that your body takes when building immunity.

Please helpppp this is due today

Answers

Answer 1

Answer:

Explanition:

The immune system is made up of special organs, cells and chemicals that fight infection (microbes). The main parts of the immune system are: white blood cells, antibodies, the complement system, the lymphatic system, the spleen, the thymus, and the bone marrow.


Related Questions

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

!!pls help!!

taj incorrectly states that autographs are also known as consumers that need to feed on other organisms, including plants and animals, to gain energy. which of the following best describes consumers that feed on other organisms such as plants and animals for energy?

A. carnivores
B. trophic levels
C. heterotrophs
D. herbivores

Answers

the answer is D) herbivores

Herbivores best describes consumers that feed on other organisms such as plants and animals for energy.

What do you mean by herbivores?

A herbivore is an animal anatomically and physiologically adapted to eating plant material, for example foliage or marine algae, for the main component of its diet.

Many herbivores have large, dull, flat teeth. These teeth are excellent for chewing and breaking down tough plant material. Carnivores have sharp, narrow teeth that are better for biting and tearing flesh. However, some herbivores also have strong, sharp teeth.

Examples of large herbivores include cows, elk, and buffalo. These animals eat grass, tree bark, aquatic vegetation, and shrubby growth. Herbivores can also be medium-sized animals such as sheep and goats, which eat shrubby vegetation and grasses.

Learn more about herbivores:

https://brainly.com/question/16786804

#SPJ2

what direction was the texas annexation in?

Answers

They faced washington DC

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

At which type of technonic plate boundary is a volcano least likely to occur​

Answers

Answer:  A

coz its just sliding one another

Hope it is correct

^_^

I need help with this (last question I had had the picture all black)

Answers

Answer:

I only know A

I think it's the lap

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

Which of the following processes is NOT a physical or chemical change?
a. crushing
b. weighing
c. melting
d. passing electric current

Answers

B. Weighing , because all its checking is the weight.

Answer:

b

Explanation:

doesn't change anything

If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.

Answers

Answer: C.

has different alleles on the chromosomes in a chromosome pair

Explanation:

Hetero means different.

A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.

What is the particular trait for heterozygous organism?

When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.

Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.

The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.

Therefore, has different alleles on the chromosomes in a chromosome pair.

Learn more about heterozygous here:

https://brainly.com/question/29327683

#SPJ2

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

Explain which processes take place during meiosis that lead to variation in inherited traits.

Answers

Answer:

We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

Identify the converted product of the photosynthesis process.​

Answers

During the process of photosynthesis plants break apart the reactants of carbon dioxide and water and recombine them to produce oxygen (O2) and a form of sugar called glucose (C6H12O6).

what were some of the earliest life forms? and what were they like

Answers

The earliest forms of life were microorganisms. These organisms appeared about 3.77 billion years ago.

Not all members of a species are the same. Every species exhibits (blank)
. For example, some beetles are green, while others are brown.

Not all individuals in a population will survive to reproduce. Those that do, pass their (blank)
to their offspring.

Answers

variation and traits

Answer:

Not all members of a species are the same. Every species exhibits  

variation.

For example, some beetles are green, while others are brown.

Not all individuals in a population will survive to reproduce. Those that do, pass their traits, genes to their offspring.

Explanation:

Got it right. Hope it helps :)

All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?

Answers

Answer:

are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.

Explanation:

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI

Answers

Answer:

Did you copy and paste this from somewhere because i want to help but i don't understand it at all.

Explanation:

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

.
Why are some sources of sugar better than others?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{Answer:❣}}}}}[/tex]

Whether an added sugar contains more or less fructose versus glucose has little impact on health. (An exception may be people with diabetes who need to control their blood glucose, in which case a higher-fructose, lower-glucose sugar may be preferable

Answer:

Some sugar that's made is usually take and unhealthy, but other sources can be purely made with no artificial s added to it making it fake.

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Other Questions
Cheri uses her Tune-It-Up music card to make a $12 purchase of a few of her favorite songs. Which integer represents the effect of Cheri's purchase on the balance of her music card?A)$12B)$11C)$0D)$12 Find the arc length of the semicircle. 8 Car dealer ben carte paid 97 percent of the base price of 22,567. he also paid 93 percent of options totaling 3,465. and a destination charge of $650. what is the dealers cost Can someone please recomend a tearpuller or heartfelt book to me? :D Someone please help ASAP help, i need help on this last question i have. the article i read didnt help What is the length of AC? In which part of the digestive system does a CHEMICAL change of the food first occur? HELP 20 points to whoever gets this rightWhat should a thesis statement include?a list of all the facts presented in the essaykey details from sources backed up with evidencebackground about the topic and supporting detailsthe topic of the essay and an opinion about the topic 5 million in total liabilities 4 million dollars in the balance sheet net worth Calculate the debt to worth ratio Jordan found cloth for $7.50 per yard. How much would his total cost be if he needed 12 yards of cloth? PLEASE HELP DO THE ONES THAT ARE CIRCLED IT DIDNT TELL ME ANYTHING ELSEFind the absolute value. 17.-|8|18. |13|19. |3 6/7|20. |-134|please help i dont know how to do this. I just went back to in person school and I told her it never taught me this. she argued with me and basically teach myself from pages of the math book. and I figured out some stuff but im confused with this part I'd love it if you'd help. what number has a value between -5 and -4 Find the value of a. A cactus with the genotype Kkww is crossed with a cactus with the genotype KKWw. Which of the following genotypes will be shared by 25% of the offspring?A. KKWWB. kkWwC. KKwwD. KkWW can someone pls help me with this!! Acela Express, the fastest train between Washington D.C and Boston covers a distance of 455 miles in 7 hours. How many miles will the train travel in 4 hours? s is inversely proportional to t.When s=0.3, t=8Work out s when t=0.4 find the equation of a line which passes through (2 4) with a slope of Rani bought 9 similar notebooks. She gave the cashier $10 and received change of $5.05. What was the cost of 1 notebook?