An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.

Answers

Answer 1

Answer:

B

Explanation:

there are complex feeding mechanisms at work to protect the other species in the food web


Related Questions

HELP!!!
[BWS.05]Where would positively charged particles be most likely found in an atom?
O around the electrons
O inside the electrons
O inside the nucleus
O outside the nucleus

Answers

Answer:

inside the nucleus

Explanation:

protons and nuetrons are in the nucleus, electrons are the ones that orbit a nucleus

Which of the following would NOT be considered growth and development?

Answers

The statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.

What is growth and development?

Growth in living organisms refers to the increase in size and number of living cells while development refers to the progressive changes in within an organism.

Growth and development can be exemplified by the following scenarios:

A single cell getting larger before dividingAn egg becoming multiple cellsAn organism going through multiple stages of life

Therefore, this reveals that statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.

Learn more about growth and development at: https://brainly.com/question/8347621

How many miles away is the moon from earth?

Answers

The moon is 238,900 miles away from earth

Which one of the following is the softest?

(A) Aluminium

(B) Iron

(C) Lithium

(D) Sodium

Answers

Answer:

Sodium

Explanation:

Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .

A divergent boundary at two oceanic plates can result in a
-mid-ocean ridge
-volcanic island arc
-continental volcanic arc
-subduction zone

Answers

The answer is -volcanic island arc.

Effects that are found at a divergent boundary between oceanic plates include: a submarine mountain range such as the Mid-Atlantic Ridge; volcanic activity in the form of fissure eruptions; shallow earthquake activity; creation of new seafloor and a widening ocean basin.

I have many questions for my hw
Here are all the facts:
A girl, lets call her Grace, is wondering which pet she should get. she has owned a betta fish before, and has done a lot of research for hermit crabs. But here are some things she doesn't know:

1. Which one is easier to care for? Betta fish or hermit crab
2. Will a hermit crab be ok in a five 1/2 gallon tank?
3. Is it ok if she just gets one hermit crab or should she get multiple?
4. And ultimately, which one should she get, hermit crab or betta fish?

The last one is the most important. Thanks!

Answers

Answer:

1. Betta Fish

2. Yes. Choose a terrarium that has at least 5 gallons of space per 2 crabs.

3. They require companionship! Hermit crabs, despite their name, are social creatures that thrive best in groups of two or more.

4. Both are entertaining, but I prefer betta. Hermit crabs, in my experience, are extremely sensitive and difficult to keep alive. Hermit crabs proved to be much more difficult than I anticipated, but bettas are a little more straightforward. That is just my opinion; I am sure you will do fantastic with whatever you choose.

I hope this helps you

:)

Which of the following describes a step in recycling raw materials to make the same or new items?

I. Use a directory to learn how to recycle a material.
II. Use refillable water bottles.
III. Use up a product completely.

I only
II and III
I and III
I, II, and III

Answers

Answer:

I only --- Use a directory to learn how to recycle

Explanation:

Number II and III do not help in recycling raw materials to make same or new (just took test got it right)

Using a directory to learn how to recycle a material is the step in recycling raw materials to make the same or new items. The correct option is A.

What is recycling?

Recycling is the process of converting waste materials in to other unique raw materials for the production of innovative products.

A material with high recyclability is one that can be easily recycled, which also means that its material properties need not depreciate significantly compared to those of simple material.

Recycling consists of three steps namely collecting recyclable materials, transforming recycled materials into new products, and selling and purchasing products containing recycled material.

The step in recycling raw materials to make the same or new items is to use a directory to learn how to recycle a material.

Thus, the correct option is A.

For more details regarding recycling, visit:

https://brainly.com/question/11861824

#SPJ5

Which of the following is the strongest conclusion to an informative essay about Sherlock Holmes's strongest character traits as a detective?

A. In conclusion, Sherlock Holmes's drive to find answers and his observation skills led to his success as a detective. Plenty of readers admired this detective and went on to become detectives, too. While none were as famous as Holmes, many joined him in saying, "It's elementary, Watson!"

B. In summary, Sherlock Holmes was determined to find answers, no matter what.
He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

C. To conclude, Sherlock Holmes became a detective so that he could use his character traits for good. He searched for answers in The Mystery of the Lost Gem, even when Mrs. Blakely doubted him. Sherlock's drive to find answers was rewarded at last.

D. To summarize, Sherlock Holmes's character traits led to his success as a detective. Many readers admired this detective and tried to imitate him, even going so far as to say, "It's elementary, Watson!"

Answers

The strongest conclusion to this informative essay about Sherlock Holmes is: B. In summary, Sherlock Holmes was determined to find answers, no matter what. He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.

What is an informative essay?

An informative essay can be defined as a literary work that presents factual information about an event, people, places or things.

This ultimately implies that, the main purpose of an informative essay is to provide sufficient information and explanation about an event, object, person (individual), places, or phenomenon to the readers (audience).

In this context, Sherlock Holmes's strongest character traits such as his five senses, as a detective should be highlighted or presented to the readers (audience).

Read more on informative essay here: https://brainly.com/question/19949636

Which environmental change would most likely result in bullfrog offspring that are able to store more water than bullfrogs in previous generations?
A.
a dry season that lasts for a month
B.
flooding that turns the valley into a lake
C.
a drought that lasts for a very long time
D.
a rainy season that lasts for a month

Answers

Answer:

C.

a drought that lasts for a very long time

True or False? A forest of conifers holds more living matter than tropical rainforests.

A. True

B. False

Answers

Answer:

true

Explanation:

The statement "a forest of conifers holds more living matter than tropical rainforests" is definitely true.

How do coniferous forests differ from tropical rainforests?

Tropical Rainforests undergrowth is evenly distributed. Not much plant growth as very little sunlight passes through the canopy and reaches the forest floor, But coniferous has little undergrowth due to the low amount of sunlight received and the low soil nutrient.

The tropical rainforests have higher and large heights of trees and other vegetation. Due to this, other living matter must definitely be inhibited due to the absence of sunlight.

While in conifers, the height of trees and other vegetation is shortly limited, due to which other living matter also receive a high amount o sunlight. As a result of this, they grow and reproduce successfully.

To learn more about Tropical rainforests, refer to the link:

https://brainly.com/question/1146251

#SPJ2

Which of the following would not be found in blood serum? (2 points)

Antibodies
Platelets
Nutrients
Wastes

Answers

Answer: The answer is (B) Platelets. You wouldn't find Platelets in blood serum.

Explanation:

Which behavior is a response that is determined by heredity?
O fighting for protection
O All behaviors are determined by heredity.
O hunting in packs
O sleeping

Answers

Which behavior is a response that is determined by heredity?

Answer:

D. Sleeping

D.) sleeping

Behavioral responses such as sleep has been found to be hereditary or affected by your genes.

[tex]#Keeplearning [/tex]

Question 9 of 10
Which three plates touch the South American plate?

Answers

Answer:

South American plate is bounded by African plate in the east, Nazca plate in the west, Antarctic plate and Scotia plate in the south, and Caribbean plate and North American plate in the north.

Explanation:

Ya'll I need serious help give a brotha sum help
What would create more genetic variation: only independent assortment (round 1 and 2) or a combination of crossing over and independent assortment (round 3)?

Answers

Answer:

A combination of crossing over and independent assortment (round 3)

Explanation:

:)

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes.

2.

A tetrad is made up of

A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids.

3.

Which of the following statements about crossing over is TRUE?

A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above

4.

Crossing-over occurs during prophase I of meiosis.

A) True
B) False

5.

Crossing-over allows the reassortment of linked genes.

A) True
B) False

Answers

A crossover in meiosis is an exchange of genetic material between

A) sister chromatids of the same chromosome.

B) sister chromatids of homologous chromosomes.

C) sister chromatids of non-homologous chromosomes.

D) non-sister chromatids of homologous chromosomes.

E) non-sister chromatids of non-homologous chromosomes. ✓

During meiosis, the two chromosomes in each parent,swipe their place resulting in a hybrid new genetic material

2.A tetrad is made up of

A) four non-homologous chromosomes.

B) four non-homologous chromatids.

C) four homologous pairs of chromosomes.

D) two homologous pairs of chromosomes.

E) two homologous chromosomes, each consisting of two chromatids.

Tetrad is a group of four chromatids formed in pachytene stage of meiosis

3. Which of the following statements about crossing over is TRUE?

A) It occurs only in males.

B) It occurs only in some chromosomes.

C) It occurs only between genes that are heterozygous.

D) It results in reduced genetic variation among gametes.

E) None of the above

The process of crossing over takes place between homologous chromosomes to increase genetic diversity

4.Crossing-over occurs during prophase I of meiosis.

A) True ✓

B) False

crossing over helps in genetic variation and occurrs between prophase 1 & metaphase 1

5. Crossing-over allows the reassortment of linked genes.

A) True

B) False

Crossing over helps in the reassortment of non-sister chromatids of non-homologous chromosomes
A crossover in meiosis is an exchange of genetic material between non-sister chromatids of homologous chromosomes. Thus, the correct option for this question is D. A tetrad is made up of two homologous chromosomes, each consisting of two chromatids. Thus, the correct option for this question is E. The statement which is true about crossing over is none of the above. This is because the process of crossing over occurs between homologous chromosomes. Thus, the correct option for this question is E. The statement "the process of crossing over occurs during prophase I of meiosis" is definitely true. The statement "Crossing-over allows the reassortment of linked genes" is definitely true.

What is Crossing over?

Crossing over may be defined as the process through which the exchange of genetic material between homologous chromosomes takes place that results in the mixture of parental characteristics in the offspring.

According to the context of this question, the process of crossing over takes place during the Pachytene stage of meiosis which significantly involves the reassortment of linked genes.

Therefore, each of the given questions is well answered above.

To learn more about Crossing over, refer to the link:

https://brainly.com/question/927405

#SPJ2

What is the mRNA that would be transcribed from this strand of DNA?

Answers

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

The objective lenses of the compound light microscope are attached to the

Answers

Answer:

C

Explanation:

its C

Answer:

The objective lenses of the compound light microscope are attached to the rotating nosepiece.

Explanation:

Which part of the plant carries water and food to and from the leaves? veins leaf blade petiole chloroplast

Answers

Veins is the part of the plant that carries water and food to and from the leaves.

Which part carries water in the plant?

The xylem distributes water and minerals through the plant i.e. from the roots to the leaves through their vein network while on the other hand, phloem carries food from the leaves to the roots.

So we can conclude that Veins is the part of the plant that carries water and food to and from the leaves.

Learn more about water here: https://brainly.com/question/1313076#

Answer: The veins.

Explanation:

Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?​

Answers

Higher pleasure is a pleasure that would be chose by a greater number in the population.

What is higher pleasure?

The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.

I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.

What is higher pleasure: https://brainly.com/question/22406307

Name the chemical that helps in providing the ideal pH for pancreatic amylase to function in the human body.*​

Answers

Answer:

What is the chemical that helps in providing the ideal PH for pancreatic amylase to function in the human body?

Explanation:

This allows the protein lipase to break down and digest the fat in the small intestine much more quickly. The pancreas secretes bicarbonate to neutralize the acidity of chyme and pancreatic amylase to aid in the digestion of carbohydrates.

Penelope is adding fractions while taking a math test. What part of her brain is at work?
spinal cord
cerebrum
cerebellum
hypothalamus

Answers

Answer:

Cerebrum

Explanation:

The cerebrum is the part of the brain that includes the hippocampus, which is responsible for solving math problems.

Answer:

cerebrum

Explanation:

edge 2022

Label what each letter means (photosynthesis)

Answers

Answer:

A- sunlight B-Oxygen C-carbon dioxide emission

Explanation:

biology The studly of cells is called what​

Answers

Answer:

Cytology is the study of cells as fundamental units of living things.

How does tsunami occurs? explain its effect

Answers

A tsunami usually occurs after an earthquake. Tsunamis can cause flash floods, destroy building and ships, cause extensive damage to human made objects as well as the environment, and cause death to both humans and animals.

If the side of a cubical cell doubled, what would the cell then require? Select all the correct answers.

A. eight times more nutrients
B. to excrete eight times more waste
C. four times more nutrients
D. to excrete four times more waste

Answers

Given what we know, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

Why would the cell require more nutrients?

This has to do with the ratio between surface area and volume. Since volume is squared when calculating it, the volume of a cell increases much more rapidly than that of its surface area. So a cell that doubles in size would quadruple in volume, needed four times as many nutrients to maintain its internal processes.

Therefore, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.

To learn more about cells visit:

https://brainly.com/question/5763151?referrer=searchResults

Which of the following can cause damage to blood vessels if not treated?
hypertension
smoking
obesity
genetics

Answers

Answer:

hypertension

Explanation:

because high blood

Answer:

hypertension

Explanation:

High blood pressure is a major risk factor for cardiovascular disease.

- Explain the differences in growth between animals and plants

Answers

Answer:

The differences are given below

Explanation:

Plants differ from animals in their manner of growth. As young animals mature, all parts of their bodies grow until they reach a genetically determined size for each species. Plant growth, on the other hand, continues throughout the life span of the plant and is restricted to certain meristematic tissue regions only.

A student is designing a device for humans to communicate through detectable light. Which waves should the student use from the electromagnetic spectrum? A X-ray waves B visible waves C infrared waves D ultraviolet waves

Answers

A.it should be a x-ray waves

when did dinos die? when tell me please​

Answers

Answer:

65 Million years ago

Explanation:

I looked it up

Answer:

65 million years ago during the Jurassic and Triassic eras, a giant meteor struck what would be earth, and we had to start all over again. Here we are 65 million years later.

I hope this helps! Have a wonderful day.

Compare how energy is used worldwide with how it is used in the United States.

Answers

Answer:

the U.S comsumes almost 15% of the worlds energy

Explanation:

yes

Other Questions
You wish to test the following claim ( Ha) at a significance level of =0.02 H0:1=2Ha:12You believe both populations are normally distributed, but you do not know the standard deviations for either. We will assume that the population variances are not equal.You obtain a sample of size n1=16 with a mean of M1=66.2 and a standard deviation of SD1=10.6 from the first population. You obtain a sample of size n2=26 with a mean of M2=68.8 and a standard deviation of SD2=12.9 from the second population.What is the test statistic for this sample? (Report answer accurate to three decimal places.)test statistic = What is the p-value for this sample? For this calculation, use the conservative under-estimate for the degrees of freedom. The degrees of freedom is the minimum of n1 - 1 and n2 - 1. (Report answer accurate to four decimal places.)p-value = Enter a number in the blank space so that the equation will have no solution. The equation: 7w+6+2w= _ (w+2) A key step in developing a new explanation is:______.a. making observations about a place or process. b. asking questions about the observations. c. proposing an interpretation that can be tested. d. collecting new observations to test predictions. e. All of these choices are correct. Which of the following statements would not be considered a clinical benefit to labeling an individual with a mental illness? a. a diagnosis can provide information effective in helping patients with disorders. b. a diagnosis provides accurate communication within the mental health community. c. individuals would have a better understanding of psychological issues and where to seek help. d. a label is subjective to clinicians and can therefore cast doubt on the patient's diagnosis. please select the best answer from the choices provided a b c d Q: Which of the following best describes communism in the United States after WWI?Select one:.O a. Many communists took the side of the labor unions and helped carry out strikes.o b. The communist party became the biggest party in the U.S. by 1925.O c. Communists typically fought against the labor unions.o d. Communists were largely ignored by the government.O Assuming that the long-run demand for oranges is the same as the short-run demand, you would expect a binding price ceiling to result in a:. How is Helium-3 different from the most common nuclear fuel- Uranium ? Which of the following is the responsibility of a phlebotomist. What formula can we use to find the surface area of a rectangular prism? Question 4 options: SA = 2lw 2lh 2wh SA = 2lwh SA = r2 SA = lw lh wh. pls help asap. i hate these questions what is the dot and cross diagram for potassium nitrate 2x 20 < -14 please help i have to find the inequality and graph the solution 4. Randall's monthly water bill from April to July is listed in the table below. What was the percentincrease in his bill from May to July? The Midwest region has been home toUS presidents. fourthree two How were the Tiananmen Square protests similar to protests in the communist bloc?A. The protesters were met with violence by the Soviets.B. Each protesting group achieved greater equality and freedoms.C. Each protesting group ended up with a new independent nation.D. The protesters were seeking democratic reforms. Which rock band was founded by Trent Reznor in 1988? There are 140 boys and 120 girls in a school. find the ratio of i, boys to girls ii, boys to the total number of students iii, girls to the total number of students i want process with answergiving answer with process making him/heras a brainlists 5 rights of delegation Why do you feel it is important to know what these rights are and how they can be used to protect the residents? Which of the 5 rights do you think is most important? Mr. Salam bought a 2-pound wheel of cheese. His family ate of the wheel. How much cheese did they eat? 1. In MNO, what is the included side of