All changes saved
2. Monique has a temperature that has always run higher than average. Because of this, it often looks like she has a low fever
when she is actually healthy. Would Monique share this information with a new doctor?
O
No, the doctor will figure it out as they continue to see Monique.
O
Yes, Monique has clearly been misdiagnosed in the past.
O
Yes, it is part of a new doctor getting to know her.
No, it is unusual so the new doctor should decide if it is a problem.

All Changes Saved2. Monique Has A Temperature That Has Always Run Higher Than Average. Because Of This,

Answers

Answer 1

Answer:

B.Yes, Monique has clearly been misdiagnosed in the past.

It would be best for Monique to share this information with a new doctor, as it is important for the doctor to have a complete understanding of Monique's health history and any relevant medical conditions. This will help the doctor make more accurate diagnoses and develop the most appropriate treatment plan. Additionally, if Monique has been misdiagnosed in the past due to her higher-than-average temperature, it's essential for the new doctor to know this information so they can take it into account when evaluating her condition in the future.


Related Questions

home health aides, nurses, and physical therapists are health care employees that make house calls on patients.

Answers

It is true that home health aides, nurses, and physical therapists are health care employees that make house calls on patients.

Healthcare seems to be the fastest-growing industry in the United States' financial system. It has almost 18 million employees. Women account for over 80% of the healthcare workforce. Healthcare professionals play critical responsibilities in our lives. They are the people we go to when we are sick or wounded, and they are the people we go to for yearly tests to ensure our health is in good shape.

Health workers are grouped into five major occupational groups: health professionals, health associate professionals, personal care workers in health services, health management and support people, and other health service providers not otherwise defined. Physical therapists assist wounded or unwell persons in regaining mobility and managing pain. Physical therapists often work in private offices and clinics, hospitals, patient's homes, or nursing homes. They spend the most of their time on their feet, interacting with patients.

To know more about the Health care employee, here

https://brainly.com/question/7442932

#SPJ4

Look at the burger in the image. What factors should you consider before purchasing the burger?

Answers

Answer:

what kind of question is that?

Explanation:

???

Answer:

You should probably think, is it healthy? Am I eating this with a balanced diet? Is it reliably sourced? Obviously, if you are eating this every day it can be extremely unhealthy and there is a higher chance of getting obesity and chronic diseases like cardiovascular disease. However, if you are eating a balanced diet it is alright to have some junk food once in a while. hope this helps! Also-please put me as the brainiest it would be most appreciated :)

Explanation:

The portion of the lips called the labial commissures is examined for

a. cracks.
b. color changes
c. variations in form.
d. all of the above.

Answers

Answer:

D. All of the above

Explanation:

The portion of the lips called the labial commissures is examined for Cracks, color change, variations in form

A patient who is complaining of intense midabdominal pain may indicate the presence of which of the following conditions?
Liver disease
Pancreatitis
Cholecystitis
Kidney infection

Answers

Answer:

I would say Pancreatitis

Explanation:

The pain should be in around midabdominal.

response time for supplemental nutrition assistance program in california

Answers

According to the California Association of Foodbanks, each county has one month after you submit your application to make a final determination on whether or not you should get CalFresh benefits.

The main federal nutrition aid programme is the Supplemental Nutrition Assistance Program (SNAP). SNAP payments are distributed to qualified low-income individuals and families using an Electronic Benefits Transfer card. This card can be used at authorised retail food establishments as a debit card to purchase qualified food.

SNAP, or Supplemental Nutrition Aid Program, is one of the main food assistance programmes in the United States. According to the latest recent data, more than 74 million Americans utilised SNAP assistance in 2021. The government's nutrition programmes give meals to those who cannot afford it in order to maintain a healthy lifestyle. In addition, the government has launched a 'eat properly' effort to educate people about eating the appropriate foods in the right amounts.

To learn more about Supplemental Nutrition Assistance Program, here

https://brainly.com/question/7672555

#SPJ4

what type of observational research studies a large group of individuals in a specific population, which may assist in identifying nutrition and exercise patterns in the population?

Answers

Epidemiological studies type of observational research studies a large group of individuals in a specific population, which may assist in identifying nutrition and exercise patterns in the population.

Where feasible, epidemiological studies seek to uncover impartial correlations between exposures such as alcohol or smoking, biological agents, stress, or chemicals and death or morbidity. An essential part of epidemiology is the discovery of causal links between these exposures and outcomes.

Epidemiologic studies serve as the cornerstone for illness control and prevention by tracking disease prevalence, defining disease natural history, and finding disease determinants or causes. It identifies illness risk factors and targets for preventive medication. The word epidemiology is increasingly frequently used to describe and explain not just epidemic and infectious illness, but disease in general, including associated diseases. High blood pressure, mental disease, and obesity are some of the problems studied by epidemiology.

To learn more about Epidemiological studies, here

https://brainly.com/question/28238114

#SPJ4

how long after starting antibiotics are you no longer contagious with strep throat?

Answers

People with strep throat should avoid going to work, school, or childcare until their fever has subsided and they have taken antibiotics for at least 12 hours.

Antibiotics are antimicrobial chemicals that kill bacteria. Antibiotic drugs are widely utilised in the treatment and prevention of bacterial infections since they are the most significant form of antibacterial agent. They have the ability to either kill or inhibit bacterial growth. A small proportion of antibiotics have antiprotozoal action.

Antibiotics are ineffective against viruses such as the common cold or influenza; instead of antibiotics, medications that decrease virus development are referred to as antiviral drugs or antivirals. They are also ineffective against fungi; antifungal medicines are those that hinder the growth of fungus. Antibiotics are used to treat or prevent bacterial infections, as well as protozoan infections in some cases.

To learn more about antibiotics, here

https://brainly.com/question/10868637

#SPJ4

which healthcare professional provides primary care?

Answers

Answer:

HOSPITALS

Explanation:

HOSPITALS ARE THE PRIMARY HEALTH CARE

Hasan knows he eats too much junk food. He wants to be healthier. Which would be the most balanced way for Hasan to make the change he desires?


Throw away all the junk food in the house.


Shock his system by going on a juice cleanse.


Start on a strict diet of only chicken and vegetables.


Try to eat at least three servings of veggies a day.

Answers

I would choose A or D because B and C are too restrictive diets and A and D are the healthiest options.

What is diet?

Diet is the total amount of food consumed by a person or other organism in nutrition. The term diet frequently refers to the use of a specific nutritional intake for health or weight-management purposes (with the two often being related). A balanced diet is one that gets at least 50% of its energy from carbs, 35% from fat, and 15% from protein. The precise optimal amounts of each nutrient will vary depending on age, gender, and activity level. A healthy diet should include the following foods: Fruits and vegetables, legumes (such as lentils and beans), nuts, and whole grains are all good sources of fiber (e.g. unprocessed maize, millet, oats, wheat and brown rice). A minimum of 400 g (five servings) of fruit and vegetables per day (2), excluding potatoes, sweet potatoes, cassava, and other starchy roots.

Here,

Because B and C are too restrictive diets, and A and D are the healthiest options, I would choose A or D.

To know more about diet,

https://brainly.com/question/28927150

#SPJ1

How does 1 of these characteristics affect at least 3 other health choices related to your physical, social or spiritual health?​

Answers

Biological and genetic, environmental, and behavioural factors are the three major categories into which the elements that influence a person's health and welfare can be grouped.

What are 3 factors that affect health and wellness?When considering how to enhance their health, the majority of people typically first consider bettering their diet and increasing their level of fitness.Cornerstones of our health and wellness are regular exercise and a balanced diet. There are other factors that affect our health besides food and exercise, though. Food and exercise alone may not have as much of an impact on a person's health and wellbeing as other variables, some of which they have no control over.While some nutrition and fitness coaches may naturally be focused on helping clients create lifestyle habits that will improve their sense of wellbeing, it is crucial to be aware of the numerous elements that influence a person's health and wellness that are unrelated to lifestyle choices.The internal and external elements that can be affecting your client's health and wellbeing are described to you in this article. Additionally, you will learn about objective and subjective health metrics and how they can be used in conjunction with one another to help you comprehend someone's current state of health.

To Learn more About health and welfare  Refer To:

https://brainly.com/question/2093822

#SPJ1

what does improving flexibility help you decrease the chances of?

Answers

Answer: it helps decrease the chance of injury

Explanation:

If Mr. Wilson includes a benefit increase option in his long-term care insurance policy, then

Answers

If Mr. Wilson includes a benefit increase option in his long-term care insurance policy, then When she is in a nursing home and the insurer has begun paying benefits.

The insurance policy is a contract between the insurer and the policyholder that specifies the claims that the insurer is legally compelled to pay. The insurer offers to pay for damage caused by risks covered by the policy wording in exchange for an initial payment known as the premium.

Long-term care insurance is a type of insurance marketed in the United States, the United Kingdom, and Canada that helps pay for the costs of long-term care. Long-term care insurance covers services that are not often covered by health insurance, Medicare, or Medicaid.

Individuals who require long-term care are usually not sick in the traditional sense, but they are unable to perform two of the six activities of daily living, such as dressing, bathing, toileting, continence, transferring (getting in and out of a bed or chair), and walking.

To learn more about Long-term care insurance, here

https://brainly.com/question/25821236

#SPJ4

which of the following is not a good example of a warm up

Answers

Answer:

decreasing the temperature of your muscles

Explanation:

Decreasing the temperatures of the muscles

11. Which statement is true about protecting your skin from sun exposure?
O A. Choose a broad-spectrum sunscreen that's SPF 15 or higher.
O B. Reapply your sunscreen every four hours.
O C. You don't need to wear sunscreen on a cloudy day.
O D. UV tanning beds are safe to use.

Answers

I think C. You don’t need to sunscreen on a cloudy day?
I hope this helps all<3

which factors could have affected the conflicting results of these studies? Check all that apply.

Answers

The factor that could have affected the conflicting results of these studies is options A, C, D, E, F and G.

Physical condition of study participantsBias of broadcastersDiet of participantsLength of studyEducation level of study participantsGenetic differences in study participantsAge of study researchers

What are the  conflicting results?

All the factors listed above could have affected the conflicting results of the studies. The physical condition of study participants could have influenced their health outcomes, and bias of broadcasters could have affected the interpretation and reporting of the study results.

Therefore, The diet of participants could have also played a role in the outcomes, as well as the length of the study, which could have affected the ability to detect changes or differences in the results. Education level of study participants and genetic differences could also have affected the results, as well as the age of study researchers, which could have influenced the design and interpretation of the study.

Learn more about results from

https://brainly.com/question/9192800

#SPJ1

See full question below

Which factors could have affected the conflicting results of these studies? Check all that apply. physical condition of study participants bias of broadcasters diet of participants length of study education level of study participants genetic differences in study participants age of study researchers

Can someone help me plss

Answers

A list of two US Scholarships and their necessary information is given below:

The Fulbright Scholarship Program: This program provides funding for graduate students, young professionals, and artists to conduct research, study, or teach abroad. Eligible applicants must be US citizens, have a bachelor's degree or equivalent, and meet the specific criteria for the country and field of study they are applying for. The application process typically includes submitting transcripts, essays, letters of recommendation, and other materials.

What is the Rhodes Scholarship?

The Rhodes Scholarship: This program provides funding for graduate study at the University of Oxford in the United Kingdom. Eligible applicants must be US citizens, between the ages of 18 and 24, and have a bachelor's degree or equivalent. The application process includes submitting transcripts, essays, letters of recommendation, and an interview with a selection committee.

Read more about scholarships here:

https://brainly.com/question/25298192

#SPJ1

4. Henry feels ashamed that he has a panic disorder. He is embarrassed that he can't just get over it on his own and doesn't want to seek treatment. Henry
commonly has negative thoughts about himself and his disorder. What type of stigma is Henry displaying?
O A Self
OB. Social
O C.Institutional
O D. Environmental

Answers

It would be self. Because he’s worrying about how he feels about himself

Drivers who don’t have a driver license from any other state country or jurisdiction muct complete. Before applying for license in Florida

Answers

Answer: TLSAE course

Explanation: Drivers who don't have a driver license from any other state, country, or jurisdiction, must complete a TLSAE course before applying for a license in Florida. The minimum legal following distance in Florida is _ A.) 1 second

after cooling a burn with cool water, what is the next step in caring for a burn?

Answers

After the burn has been cooled, cover it with cling film or a clean plastic bag.

A burn is a tissue damage produced by heat, cold, electricity, chemicals, friction, or UV radiation (like sunburn). Heat from hot liquids (known as scalding), solids, or flames causes the majority of burns. Burns are more common in the home or at work. Domestic kitchens provide threats in the house, including stoves, fires, and hot liquids. Fire, chemical, and electric burns are all threats in the job. Other risk factors include alcoholism and smoking. Burns can also occur as a result of self-harm or interpersonal aggression.

Burns that just damage the top layers of the skin are referred to as superficial or first-degree burns. A partial-thickness or second-degree burn occurs when the damage spreads into portion of the underlying skin layer.

To learn more about burns, here

https://brainly.com/question/7282608

#SPJ4

An eating disorder is an illness in which people
Group of answer choices?

A)cannot absorb nutrients in the small intestine.

B)produce too much stomach acid, leading to extreme discomfort.

C)cannot digest their food properly.

D)feel compelled to eat in a way that causes harm.

Answers

Answer: C

Explanation: Any of a range of mental conditions in which there is a persistent disturbance of eating behaviour and impairment of physical or mental health.

ITS C ITS C OMG ITS C YES C OMG C YES SHUBBY

Develops the skills of students in preparing and producing bakery/pastry products. cake and desserts.

Answers

Practicing Bread and Pastry makings.

Following the recipe as accurately as you can with all the measurements of the ingredients, using the right tools, fresh ingredients etc, are few key factors important.

To assure the manufacture of high-quality goods, preparatory ability is crucial in the production of bread and pastries. However, due to a lack of experience cooking at home, which left people lacking the necessary tools, kids today have little understanding of the value of preparation.

The Complete Question will be "What develops the skills of students in preparing and producing bakery/pastry products like cake and desserts ?"

Learn more about cooking skills at

brainly.com/question/8413752

give one example of a time the dimensions of health have affected each other in your life.

Answers

Examples include physical, mental and social health these are interrelated and greatly influenced by each other .

In general , the dimensions that contributes to our sense that includes wellness and quality of life , they all are interrelated and they also overlaps each others. At particular time one dimension may be more important then the other, but negligence of any one dimension for a course of time may have an adverse effects on overall health.

Hence, World Health Organization gave the importance of four dimensions of wellness these includes social, physical, spiritual and intellectual they all are interconnected and can affect each other. If we Integrate these four dimensions they can help with the development of a generalized path to live life more efficiently .

To learn more about World Health Organization , here

brainly.com/question/20867263

#SPJ4

the term describes the general physical and emotional states that accompany the stress response.

Answers

Stress is the term describes the general physical and emotional states that accompany the stress response.

Stress is defined as any type of change that causes physical, emotional, or psychological suffering. Stress is the body's reaction to anything that demands attention or action. To some extent, everyone is stressed. However, how one responds to stress has a significant impact on general well-being.

Stress management refers to a wide range of treatments and psychotherapies focused at lowering a person's stress level, particularly chronic stress, in order to improve everyday functioning. Unmanaged stress can lead to a number of health problems, including high blood pressure, heart disease, obesity, and diabetes. Long-term stress prevention and management can reduce your chance of developing additional disorders such as heart disease, obesity, high blood pressure, and depression.

To learn more about Stress, here

https://brainly.com/question/1588572

#SPJ4

In the Exotic Dancer Case, is it ever right to take away someone's autonomy? Explain.​

Answers

Answer:

No, it is never right to take away someone's autonomy. Autonomy is the right to make decisions and act freely without the interference of others. Taking away someone's autonomy is a form of oppression and can have a long-term negative impact on an individual's mental and physical health.

17. Scott is extremely focused on eating healthy. He will only eat organic produce. He carefully reads food labels for all grocery items he purchases and feels
stressed when eating out because he is worried about how the food was prepared. What type of disordered eating pattern is Scott demonstrating?
O A. Orthorexia
O B. Diabulimia
OC. Anorexia nervosa
OD. Bulimia nervosa

Answers

According to his symptoms I’m pretty sure it would be Anorexia. Basically ED

Answer:it’s orthorexia

Explanation: it’s. Persons who’s extremely alert of only healthy foods

First aid kits are best substituted by bandages and alcohol. True or False?

Answers

Answer:False I hope this help mark me brainlist if correct then no if wrong

Explanation:

False (There is no substitution for a first-aid kit)

A first-aid kit is a collection of basic, important, and necessary supplies that can be utilized in the case of a medical emergency. A basic home first-aid kit should include sterile gauze dressings or plasters, bandages, antibiotic ointments, antiseptic wipes, aspirin, a thermometer, and tweezers.  All these components can be utilized in medical situations such as minor cuts or wounds, broken bones, and burns; as well as certain cardiopulmonary emergencies. Alcohols such as isopropyl or rubbing alcohol are important for sterilization. However, in certain cases, they can do more harm by destroying the affected tissues. It is best that the wound is washed under running water for cleaning. Apart from this, an antibiotic ointment can prevent bacterial infections. Bandages are necessary for many emergencies. There are various different types of bandages that are available such as adhesive and gauze. However, they alone cannot be substituted for a first-aid kit. Therefore it is necessary that one carries a basic kit consisting of all the important supplies with them at all times. 

False. A first aid kit needs more than bandages and alcohol.

First aid packs contain a variety of materials for injuries and emergencies. Depending on the intended purpose and first aid level, these may contain sticky bandages, gauze pads, antiseptic solutions (such alcohol), sterile dressings, adhesive tape, scissors, tweezers, gloves, CPR masks, and other items.

First aid kits address a variety of injuries and crises until expert medical help arrives. It should have materials for cuts, burns, sprains, and more. First aid kits may also include basic first aid training or reference materials.

Learn more about first aid, here:

https://brainly.com/question/27974849

#SPJ6

______ refers to how you feel about yourself, your opinion of your personal worth or value, and the confidence you have in yourself and your abilities.
O A. Self-control
O B. Self-concept
O C. Self-acceptance
O D. Self-esteem

Answers

Answer: D. Self-esteem

Explanation: Self-esteem means having either positive or negative feelings for ourselves. I hope this helped!

It’s self esteem because it is the way a person feels about themself. It affects how confident the person feels about themself and what they can do

Sara bought a brand new pair of sandals. The first time she wore it to the prom, the sandal strap broke and she stubbed her toe and tripped. Which parts of Sara's health were affected by the sandals?

Answers

Sara purchased a brand new pair of sandals, and the first time she wore them to the prom, the sandal strap broke and she stubbed her toe, so the foot and toe are most likely to be injured.

What is the significance of the foot's health?

The foot health is important as the person's weight is carried by the leg bones, and the bones of the foot are important for the movement, so if any injury takes place in the foot, it creates problems in the movement.

As a result, Sara purchased a brand new pair of sandals, and the first time she wore them to the prom, the sandal strap broke and she stubbed her toe, so the foot and toe are most likely to be injured.

Learn more about the foot's health here.

https://brainly.com/question/29732807

#SPJ1

A nurse is assessing a client who received ondansetron 1 hr ago. Which of the following findings should the nurse identify as a therapeutic effect of the medication? Decreased pain Suppressed emesis Suppressed cough Decreased fever. Suppressed emesis

Answers

The nurse should identify Suppressed emesis and Suppressed cough as a therapeutic effect of the medication.

Ondansetron, often known as Zofran, is a drug used to treat nausea and vomiting induced by cancer chemotherapy, radiation therapy, or surgery. It is also useful in the treatment of gastroenteritis. It can be administered orally or by injection into a muscle or vein.

To avoid nausea caused by chemotherapy, take this drug 30 minutes before treatment begins. Take this drug 1 to 2 hours before the commencement of radiation treatment to avoid nausea. Take ondansetron 1 hour before surgery to avoid nausea after surgery. Ondansetron may be administered with or without meals. It does, however, act faster on an empty stomach, an hour before food, or two hours after meals.

To learn more about ondansetron, here

https://brainly.com/question/28260441

#SPJ4


Your next task is to and make an acrostic poem
about what you have learned about the risk and
protective factors of using drugs. Use the letters of
the word "RISK and PROTECTIVE" as the first letter of each stanza

Answers

Raise this land of red eyes, A breeze dances, Rain undresses.

Raise this land of red eyes, I also am not the father and the boy who rises, Say, oh ye scornful ancestor resurfaces, Killed and ravines.

A breeze dances, Natron wear their footsteps with lint and buckles, Dame, though horrified Gypsies, Passions and misfortunes.

Rain undresses, O great modern noises, Tall and straight emerged from their crooked bones, Each wave by birds in the leaves.

Cartagena always waiting for the hungry pirates, Talk to your enemies, I admire men who have gone seventies, Vice haunts us even in the midst of our pleasures. Eat and drink comrades.

To know more about Cartagena here

https://brainly.com/question/7196213

#SPJ4

Other Questions
find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y? this graph shows merchandise export data for the years 2010 through 2012. a graph titled total merchandise exports from 2010 to 2012 has year on the x-axis and exports in trillions of u s dollars on the y-axis, from 0 to 2.5 in increments of 0.5. a line representing united notes exports is slightly lower than a line representing china exports. which statement most accurately describes the information presented on the graph? during the 21st century, the complexity of the challenges posed by disruptive, digital technologies and accelerating rates of change has encouraged companies to: In order to maintain compliance with standard precautions, a medical assistant should recognize that which of the following tasks requires the use of gloves despite the absence of any visible blood?a) Administering a nebulizer treatmentb) Performing a visual acuity testc) Obtaining a tympanic readingd) Removing a cyst italian sailor credited with the discovery of the americas in 1492. true or false The key idea of John Locke's Enlightenment theory was to protect and enhance the freedoms and rights of O the government. O the philosophers. O the law. O the individual. A group of four friends spends a day at a local theme park, which has just opened a new attraction with very popular rides featuring new technology. They board one of the rides after waiting for over an hour in line, but about five minutes into the ride the electricity fails, and they are stuck on the ride for a half hour. When the ride finally resumes and concludes, they go to the theme parks guest services department to complain. What are the facts?How does the guest feel?How would you acknowledge the guests feelings?What would be your solution?How would you follow up with the guest? Read this quotation from paragraph 10."What could happen if you allowed yourself to step outside the cages and breathe in the fresh air of your freedom?"Based on the quotation, the author views her high-school years as a source of - A. transitionB. confinementC. orderD. discipline all of the following statements regarding the gulf war of 1991 are true except that select one: a. the united states suffered relatively few casualties in the war. b. the allied ground offensive focused on dislodging iraqi forces dug-in along the kuwait border. c. almost all islamic and arab nations joined a trade embargo against iraq. d. the united nations voted in favor of american policies toward iraq. e. the allied forces ultimately numbered 690,000 troops. a network administrator notifies a technician that the company is experiencing a ddos attack. several internal windows pcs are the source of the traffic. the network administrator gives the technician the windows computer names and states they be scanned and cleaned immediately. with which of the following types of infections are the pcs most likely infected? (select two.)