The best conclusion you can make about the life cycle of this cell is that the cell is in the S phase of interphase and will move next to the G2 phase.
S phase (Synthesis Phase) is the phase of the cell cycle in which all of the chromosomes (DNA) are replicated within the nucleus. During this phase, the DNA is effectively doubled as each chromosome contains two sister chromatids. After the S phase, the cell enters the G2 phase where various proteins (such as microtubules) are synthesized.
(HELP PLEASE I WASNT IN SCHOOL YESTERDAY) All of these forms of energy are involved in the human body's everyday life EXCEPT
Group of answer choices
mechanical energy
thermal energy
nuclear energy
Answer:
I'm pretty sure it's nuclear energy.
Answer:
the answer is the last one hope it helps
Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.
Caves
Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.
one is missing but u can just check it on quizlet
✨Please help ✨due soon✨
Answer:
25%
Explanation:
i believe 25% because ita very rare
Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??
Answer:
Independent variable: type of instrument
Dependent variable: Number of rabbits attracted
Experimental group: The group when he played an instrument
Control group: The group when not playing an instrument
Constant: Same song
Explanation:
1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.
2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.
3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.
4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.
5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.
how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet
Answer:
Due to no jaws, no paired fins and scales on the body.
Explanation:
Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.
The energy related to the motion of an object is called ___.
Answer:
The answer is kinetic energy
Explanation:
Do bacteria have both primary and secondary Cell walls?
Explanation:
Bacteria have a thin flexible cell wall. Only plant cells have primary and secondary cell walls.
Do all plants respond the same to all abiotic factors?
Answer:
Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
Insecticides can pollute the topsoil.
True or false ?
Answer:
True
Explanation:
Some insecticides when applied may persist for longer periods and that is very harmful because the soil is degraded and living organisms in the soil may be harmed leading to soil erosion. Then the soil will lose its fertility.
Which antivenom will save Tyler?
Select one:
a.
Antivenom A
b.
Antivenom B
c.
Antivenom C
d.
Antivenom D
Answer:
b
Explanation:
Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.
(This is 7th grade science).
like your name
Explanation:
Any one free
InboX me (◍•ᴗ•◍)❤
Answer:
hiii
Explanation:
Which cell type has organelles that are NOT membrane-bound, eukaryotic or prokaryotic? PLEASE HELP
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
(Apoptosis is? ) A)cancerous cells
B)programmed cell death
C)non-dividing cells
D)Part of the kinase/cyclin cascade
Answer:
B
Explanation:
death of a cell which occurs as a normal and controlled part of an organisms growth
Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?
The stomata of a desert cactus will close during the day.
STOMATA:
The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases. The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss. Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day. Therefore, the stomata of a desert cactus will close during the day.Learn more at: https://brainly.com/question/3387375?referrer=searchResults
The dodo bird is now extinct. What factor would not have led to its extinction?
Answer:it was well adapted to living on the island of Mauritius
Explanation:
LI:
The diagram below compares the relative diameters of two planets in our solar system.
Which two planets have diameters that most closely resemble this comparison?
1.
Uranus and Neptune
2.
Jupiter and Saturn
3
Earth and Mars
4.
Mercury and Venus
Submit Answer
Answer:
1, uranus and neptune
Explanation:
i just did it
Based on the diagram above, the two planets having diameters that most closely resemble this comparison are: 1. Uranus and Neptune.
A solar system is an astronomical system which comprises both the inner and outer planets alongside celestial bodies such as a Moon, that are typically in orbit (traveling) around the Sun in slightly elliptical orbits..
Basically, the nine (9) planets that are found in the solar system orbiting around the sun include;
Mercury. Venus. Earth. Mars.Jupiter.Saturn.Uranus.Neptune.Pluto.Generally, the planets found in the solar system vary considerably in terms of shape and size as shown below:
1. Uranus and Neptune: the mean diameter of Uranus is 50,724 km (31,518.43 mi) while that of Neptune is 49,244 km (30598.8 mi).
2. Jupiter and Saturn: the mean diameter of Jupiter is 142,984 km (88,846 mi) while that of Saturn is 120,536 km (74897.6 mi).
3. Earth and Mars: the mean diameter of Earth is 12,756 km (7926 mi) while that of Mars is 6779 km (4212.275 mi).
4. Mercury and Venus: the mean diameter of Mercury is 4,879 km (3031.67 mi) while that of Venus is 12,104 km (7521 mi).
From the above data on diameter, we can deduce that both Uranus and Neptune are mostly related in terms of size as depicted in the diagram, by using two (2) circles of equal sizes.
Read more: https://brainly.com/question/1251115
Which of the following provides the best summary of the process of natural
selection?
A. Populations become better adapted to their environment.
B. Individuals pass on their best traits to their offspring.
C. Individuals always change in response to their environment.
D. Population sizes increase with every generation.
SUBMI
Answer:
c
Explanation:
What portions of RNA are cut out and discarded during the process of RNA editing
Answer:
introns are portions of RNA that are cut out and discarded.
Explanation:
23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA
Answer:
D
explanation: it literally has physics in its name
5. The sodium-potassium pump is an example of
i. simple diffusion.
j. passive transport.
facilitated diffusion.
k. none of the above
Answer:
its passive transport
Explanation:
The sodium-potassium pump sets the membrane potential of the neuron by keeping the concentrations of Na+ and K+ at constant disequilibrium.
January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?
Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia
Answer:
its malaria
Explanation:
I got it wrong and it showed me that it was malaria
Plz help me its only 1 question
Answer:
the first one
Explanation:
the car slowly started and accelerated
Its the second one. Since its continually accelerating.
**HELP PLS**
Philippe did some research about classification for a science report. He learned that until 160 years ago, scientists recognized only two groups of microscopic organisms. How should Philippe explain why scientists decided to classify organisms into more groups?
More types of organisms exist now.
Fewer organisms have gone extinct in recent years.
Scientists invent new organisms that need to be classified.
Scientists continue to learn more about living things.
Answer:
The correct answer would be - Scientists continue to learn more about living things.
Explanation:
In past scientists continues to do various research, findings, studies and experiments regarding diferent type of living organisms and their components and body parts.
These research, studies, and many other aspects of the science helps scientists to conotinue to learn more about living things which helps in provide information that there are different type of organism and should be classified.
what do eukaryotic cells and viruses have in common?
Answer:
Just search it up
Explanation:
Hello There!
What do viruses have in common with eukaryotic cells?
-Viruses are not cells, but they do have certain things in common.
Viruses & Eukaryotic cells :-
1.Contain DNA, but not much.
2.Can not reproduce by themselves.
3.Have important features such as nucleic acid gnomes.
4.Have genetic variations and can certainly evolve.
Hope This Helps!
Thank you!!! Good Day! ♡
Which of the following below, best describes a cell from bacteria?
A. A multicellular organism
B. A cell with many organelles
C. Multicellular, Eukaryote
D. Unicellular, prokaryote
When a strong acid is added to a strong base a_________________ reaction occurs in the product will have a PH closer to_____
A. Neutralization,7
B. Ionic,0
C. Concentration,14
Answer:
A
Explanation:
Acids and bases when mixed neutralize eachother. and 7 is neutral on the PH scale