5c + 7c simplify fytdtdecxsts

Answers

Answer 1

Answer:

12c

Step-by-step explanation:

Note that when simplifying through adding or subtracting, the terms must have the same amount of the same variables to combine them.

In this case, all given terms have the same variable, denoted by c. Combine the given coefficients:

5c + 7c = 12c

12c is your answer.

~


Related Questions

Jose left the airport and traveled toward the mountains. Kayla left 2.1 hours later traveling 35 mph faster in an effort to catch up to him. After 1.2 hours Kayla finally caught up. Find Jose's speed.

Answers

Answer:   20 mph

========================================================

Explanation:

x = Jose's speed in mph

x+35 = Kayla's speed since she drives 35 mph faster than Jose

Jose gets a 2.1 hour head start and it takes Kayla 1.2 hours to reach him. So this means Jose has been driving for 2.1+1.2 = 3.3 hours when Kayla reaches him. The distance he travels is

distance = rate*time

d = r*t

d = x*3.3

d = 3.3x

while Kayla's distance equation is

d = r*t

d = (x+35)*1.2

d = 1.2x+42

Since Kayla meets up with Jose at the 1.2 hour mark, this means the two distances they travel is the same. Set their distance expressions equal to one another. Solve for x.

3.3x = 1.2x+42

3.3x-1.2x = 42

2.1x = 42

x = 42/(2.1)

x = 20

Jose's speed is 20 mph, while Kayla's speed is x+35 = 20+35 = 55 mph.

Jose's fairly slow speed is probably due to a number of factors such as heavy traffic, icy roads, or poor visibility. Kayla probably got a bit of a break with more favorable conditions.

Since Jose travels at 20 mph and does so for 3.3 hours, he travels d = r*t = 20*3.3 = 66 miles. Kayla travels d = r*t = 55*1.2 = 66 miles as well. We get the same number each time to help confirm the answer.

To bring a "carry-on" bag onto an airplane the bag needs to weigh less than 25 pounds. Right now Julie's carry-on bag weighs 32 pounds. How much weight must Julie remove from her bag?

Answers

My answer needs to be 32-25=7

State whether the system is consistent or inconsistent. If it is consistent, then state whether the graphs' equations are dependent or independent. State the number of solutions.

Answers

If a system has at least one solution, it is said to be consistent . If a consistent system has exactly one solution, it is independent . If a consistent system has an infinite number of solutions, it is dependent . When you graph the equations, both equations represent the same line.

can you help me solve 4x - 15 = 17 - 4x

Answers

[tex]4x-15 = 17-4x\\\\\implies 4x +4x = 17 +15\\\\\implies 8x = 32\\\\\implies x = \dfrac{32} 8\\\\\implies x = 4[/tex]

The impact on sampling of increasing the sample size is: There is no specific relationship between sample size and sampling error.

Answers

Using margin of error, it is found that increasing the sample size results in a smaller sampling error.

The equation for the margin of error is given by:

[tex]M = c\frac{s}{\sqrt{n}}[/tex]

In which:

c is the critical value according to the distribution used.s is the standard deviation, either of the sample or of the population.n is the sample size.

From the equation, it can be noted that the margin of error is inversely proportional to the square root of the sample size, hence, increasing the sample size results in a smaller sampling error.

To learn more about margin of error, you can take a look at https://brainly.com/question/25821952

Does anyone know the answer for this question? I really need it.

Answers

Your answer is 9 1/3

3 x 9 1/3
= 3/1 x 28/3
= 84/3
= 28

The table shows the final score of four golfers.
Golfer Final Score
Joe
-2
Allen
-5
Tara
-8
Violet
-4
Whose score was the lowest? Whose was the highest? Select your answers from the drop-down lists.
score was the lowest.
score was the highest.
Students, draw anywhere on this slide!
PER Deck eractive Skoe

Answers

highest is joe because it the most closest to 0
Lowest is Tara because it the most far from 0

Answer:

Joe score was the highest. Tara score was the lowest.

Step-by-step explanation:

Evaluate.

(jk−1)÷j when j=−4 and k=−0.7

Enter your answer as a decimal in the box.

Answers

Answer:

(jk - 1) / j

jk = (-4 x -0.7) = 2.8

(2.8 - 1) / - 4

1.8 / -4 = -0.45

Answer is -0.45 when j = -4 and k = -0.7

Four times a number is equal to the number increased by 24 find the number

Answers

Answer:

8

Step-by-step explanation:

Let the number is x.

Translate the given into equation and solve for x:

4x = x + 244x - x = 243x = 24x = 8

emma has 63 pencils noah has 49 penecils and michel has 77 pencils.Use the GCF and the distributive property to find the total number of pencils

Answers

Step-by-step explanation:

the greatest common factor (GCF) is 7.

it is 9×7, 7×7 and 11×7.

so the total number of pencils is

7×(9 + 7 + 11) = 7×27 = 189

Classify the Triangle by its sides and angles. 140° Right Scalene Right Isosceles Equilateral Obtuse Isosceles Acute Isosceles Obtuse scate Acute Scalene​

Answers

Answer: Obtuse Isosceles.

Explanation: Two angles are congruent, which means the triangle is isosceles. One angle is over 90°, which means the triangle is obtuse.

what is the answer i need done by midnight -15x+60<105

Answers

Answer:

[tex]x > -3[/tex]

Step-by-step explanation:

Isolate the variable. Treat the < sign like an equal sign, in that what you do to one side, you do to the other.

Do the opposite of PEMDAS. PEMDAS is the order of operations, and stands for:

Parenthesis

Exponents (& Roots)

Multiplications

Divisions

Additions

Subtractions

~

First, subtract 60 from both sides of the equation:

-15x + 60 (-60) < 105 (-60)

-15x < 45

Next, divide -15 from both sides of the equation. Note that when you multiply or divide a negative number, you must flip the sign:

(-15x)/-15 < (45)/-15

x < 45/(-15)

x > -3

[tex]x > -3[/tex] is your answer.

~

When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh?

Answers

Answer:

8.705-4.93=3.775

Hope This Helps!!!

Activity 1.
Direction. Using the diagram below, form ratios. Express them in lowest term to
To form a proportion

Answers

Answer:

6:3 =2:12:2=1:16:13:24:14=2:7

To get to the next term in this sequence, multiply the last term by 2.5. What is the value of the next term?

1, 2.5, 6.25, 15.625, ...

HELP ASAP WILL GIVE BRAINLIEST

Answers

Answer:

39.0625

Step-by-step explanation:

15.625 times 2.5= 39.0625

You're just multiplying each value by 2.5

1 times 2.5= 2.5

2.5 times 2.5= 6.25

6.25 times 2.5= 15.625

and then 15.625 times 2.5= 39.0625

Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)?

Answers

Answer:

f(8) = $48

EQUATION

f(x)= 8+5(x)

Step-by-step explanation:

initial value = $8

every week there is an additional $5 added.

f(x) = 8+5x

f(8) = 8+ 5(8) = 8 + 40 = 48.

At the end of week 8 (x=8) , Jamal has $48 (y=48) saved.

Determine if the sequence below is arithmetic or geometric and determine the common difference/ ratio in simplest form

15, 11 ,7, …

Answers

Answer:

This is the arithmetic sequence which has a common difference that equals to -4.

Step-by-step explanation:

An arithmetic sequence is a sequence with common difference. A common difference can be found by subtracting previous term with next term.

A common difference can be expressed in [tex]\displaystyle \large{d=a_{n+1}-a_n}[/tex] where d stands for common difference.

________

Moving to the question given. We have a sequence with given 15,11,7, ... first subtract 15 with 11.

11-15 = -4

7-11 = -4

Therefore, we can conclude that the common difference is -4 thus making the given sequence an arithmetic.

Let me know if you have any question so regarding the sequence!

1) f(4) = g(4)
2) f(4) = g(-2)
3) f(2) = g(-2)
4) f(-2) = g(-2)

Answers

Answer: 4)

Step-by-step explanation:

f(4) = -14

g(4) = 10

g(-2) = 4

f(2) = -8

f(-2) = 4

The correct statement is 4) f(-2) = g(-2)

Or by inspection, we can see that the graph f(x) intersects g(x) at x = -2 and    y = 4. So, f(-2) = g(-2) = 4 is true

Is this table proportional?
XY
1 3 3
4 12
5 15
7 21

Answers

Yes it is proportional for a table

line passes through the points (4,-2) and the slope is 5/4 write an equation in slope intercept form

Answers

Answer:

y=5/4x -7

Step-by-step explanation:

Hope this helps!

Understand how to work with negative bases and negative exponents.
5^2 =
5^-2 =
(-5)^2 =
- 5^2 =
(Remember to find the base, then multiply.)

Answers

Answer:

[tex]Understand \: how \: to \: work \: with \: negative \: bases \\ \: and \: negative \: exponents. \\

\bold{answer - } \\ {5}^{2} = 5 \times 5 = 25 \\ {5}^{ - 2} = \frac{1}{ {5}^{2} } = \frac{1}{25} = 0.04 \\ {( - 5)}^{2} = ( - 5) \times ( - 5) = 25 \\ - {5}^{2} = ( - 5) \times ( - 5) = 25 \\ \\ \bold \purple{hope \: it \: helps \: ♡}[/tex]

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

HELP ASAP PLEASE THIS IS FOR ALGEBRA

1. he slope of a line through the points (-2, 4) and (6, b) is -3/2 What is the value of b?
Explain your method for calculating b.

Answers

Answer:

Step-by-step explanation:

Use the slope formula to solve this problem. Slope, usually called m, is the change in y-values over the change in x-values.

m = (y2 - y1)/(x2 -x1)

It actually doesn't matter which point is the first point and which point is the second point. But you must be consistent.

So fill in -3/2 for the m

Let your (6, b) be your (x1, y1)

Let (-2, 4) be your (x2, y2)

So, the numbers fill into the formula like so:

-3/2 = (4 - b)/ (-2 - 6)

-3/2 = (4 - b)/(-8)

Multiply -8 on both sides of the equation.

(-8)(-3/2) = 4 - b

12 = 4 - b

Subtract 4 from both sides.

Don't lose the negative in front of the b

8 = -b

Multiply or divide by -1 on both sides.

-8 = b This is the answer.

**note: Its kinda crummy to use b in this equation, because b has a special meaning when you are working with linear equations. They should have given you a different variable. b usually stands for the y-intercept but in this problem it doesn't, it's just a variable representing an unknown value.

What is an equivalent ratio

Answers

Answer:

Equivalent ratios (which are, in effect, equivalent fractions) are two ratios that express the same relationship between numbers. We can create equivalent ratios by multiplying or dividing both the numerator and denominator of a given ratio by the same number. Two ratios that have the same value are called equivalent ratios. To find an equivalent ratio, multiply or divide both quantities by the same number. It is the same process as finding equivalent fractions.

when 2 ratios are the same or equivalent by simplifying. For example 1 to 4 is the same as 2 to 8 because when I simplify it i get 1 to 4

Which one is correct

Answers

D IS CORRECT BC 30/-2 =-15 AND WHEN U DIVIDE 30 BY A NEGATIVE NUMBER THE SIGN FLIPS THE OTHER WAY

Solve for x: one over eight 1/8(8x + 15) = 24

Answers

Answer:

22[tex]\frac{1}{8}[/tex]

Step-by-step explanation:

I hope this helps!!!

SCO
Sarah put 15 gumdrops on the roof of her
gingerbread house. How many gumdrops
will she need to make 16 more houses
exactly like this one?
MY
gumdrops

Answers

Answer: 240 gumdrops

Step-by-step explanation:

1 house: 15 gumdrops

16 houses : 240 gumdrops

1 x 16 = 16

15 x 16 = 240

help me plz ineed help

Answers

Answer:

23°

Step-by-step explanation:

Opposite angles so:

60° = 2x + 14

Therefore:

x = 23°

Answer:

x is 23°

Step-by-step explanation:

those opposite angles and are always equal to each other...so to get x take 60-14 then answer divide by two

A desk drawer is shaped like a rectangular prism. The height of the drawer is 7 inches. The bottom of the drawer has an area of 210 square inches.

What is the volume of the desk drawer?

Enter your answer in the box.

Answers

Answer:

1470 inches cubed

Step-by-step explanation:

Vol=length × width × height

But ALSO,

length × width = Area,

So we find another Volume equation,

Vol = BaseArea × height

This is the information you are given in the question.

Vol = 210 × 7

Vol = 1470 inches cubed

Help me please i really need it​

Answers

Answer:

Step-by-step explanation:

RSB is a right angle

12. RSB is 90 degrees

13. A right angle is 90 degrees

H is between P and S

14. PS + PH = HS

15. Deductive Reasoning

Other Questions
Rewrite this paragraph filling in the missing punctualmarks:CarsThe first car was a machine that had three wheels and was powered bysteam__ It was built in France in 1769 _ it was heavy and moved very slow .Many factories produced steam-driven cars during the 1890s and 1900sbut the disadvantage of steam was that water had to be boiled before thecar could go. Nowadays cars work on gascars work on gas_ electric , and even on water,which prove that science never stop inventing- AYUDA,encontre criterio pero no encontre nada mas Determine which number is greater and tell how many times as great. 71012 and 3.5109 in the pediatric unit of a hospital has 165 beds how many are there if each room holds 3 beds please match the year to the event. WILL GIVE BRAINLESTS noah does half as many push-ups as joseph. joshua does 3 times as many push-ups as joseph. they complete 324 altogether. How many push-ups does joshua complete? Which of the following statements is the best way to state your position in a conflict?a.I am concerned you arent telling people the truth about me.b.I feel betrayed by what was said about me.c.You arent telling me what you tell other people.d.You need to let me know what you think about me to my face. [1(23x5)]/2Solve this questionsssssdfghfght Which best explains why a person can tell the difference between a whisper and a yell?O Sound waves turn into chemical signals that indicate certain sounds.Different vibrations in the ear cause the bras o interpret different sounds.The fluid in the cochlea picks up electrical signals for the intensity of sound.The eyes see what is making the noise and help the brain process the sound. The energy required to cause a gaseous atom or ion to release a electron is what? Plz help!!! i rlly need help :(STORY: The Winter Hibiscusquestions are below! best responses will be marked as BRAINLIEST!!! :D1. What does the Winter Hibiscus symbolize? Use examples from the text to support your response. *2. When discussing literature, the term "dynamic character" means simply a character who undergoes some important change in the course of the story. Who is a dynamic character in "The Winter Hibiscus"? Why should this character be considered 'dynamic'? Provide evidence/examples from the beginning and the end of the story to support your response. *3. What is the theme of the short story "The Winter Hibiscus"? What example(s) and/or event(s) from the text prove this? *4. Based on her experiences in the story, what is the most difficult conflict that Saeng must face? (You can choose any of her internal conflicts or either of her external conflicts: Saeng vs. her mother, Saeng vs. her new environment in the United States) Use examples/evidence from the text to support your ideas. *5. Using the list of generational conflicts on the whiteboard in the front of the classroom, what is the most dominate generational conflict in "The Winter Hibiscus?" Explain your ideas using examples from the text. * Which war led to the US participating in an international peace conference? 0.15% of what number is 10.5 Which of the following lines are perpendicular to the line y= -1/2x +4 ? (you may choose more than one answer) A. 2x - y = 1 B. y = 2x C. 2x + y = 1 D. 1/2x - y =2 E. 2x - y = 3 Cassidy is selling popcorn for a fundraiser sale at the price shown. he purchases a total of 150 containers of popcorn to sell. after he sells 25 containers, he will make a total profit, after his upfront costs, of $5.50 cassidy's profit, after upfront costs, can be modeled by a linear function in the form of y=mx+b. C. Will the function be discrete or continuous? Explain. D. Write the function that models Cassidy's profit. E. What is the domain of the function? F. What is Cassidy's profit or loss if he does not sell any popcorn? G. What is cassidy's profit if he sells all the popcorn? H. What is the range of the function? 9. Sofija buys a bracelet for $14.50 plus 8% tax.Momoka buys a necklace for $12 plus 8% tax.Enter the sum, in dollars, that Sofija andMomoka paid, including tax. Blank blank and blank are examples of nonverbal communication. What is the sum of 7/13 and 11/26? Please help!! What are 10 methods used to uncover the past climates of the earth including their strengths and weakness Write the charges for each part of this equation.